I-CTS6364 (Y-DNA)

Haplogroup I-M253(I-CTS6364)

Haplogroup I1 (M253) Wikipedia

• Possible time of origin 3,170–4,600[1]-5,070 BP (today's diversification)[2][3] (previously 11,000 BP[4] to 33,000 BP[5]%29 27,500 (diversification with I2-FGC77992)[1]
• Possible place of origin Northern Europe
• Ancestor I* (M170)
• Descendants I1a (DF29/S438);
• I1b (S249/Z131);
• I1c (Y18119/Z17925)
• Defining mutations M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187
• Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187.[6] It is a primary branch of Haplogroup I-M170 (I*).
• The haplogroup is believed to have been present among Upper Paleolithic European hunter-gatherers as a minor lineage but due to its near-total absence in pre-Neolithic DNA samples it can't have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a founder effect in the Nordic Bronze Age. Today it reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province).[7] In terms of national averages, I-M253 is found in 38-39% of Swedish males,[8][9][10] 37% of Norwegian males,[11][12][13] 34.8% of Danish males,[14][15][16]34.5% of Icelandic males,[17][18][19] and about 28% of Finnish males.[20] Bryan Sykes, in his 2006 book Blood of the Isles, gives the members – and the notional founding patriarch of I1 the name "Wodan".[21]
• Haplogroup I-M253 is a primary branch of haplogroup I* (I-M170), which has been present in Europe since ancient times. The other primary branch of I* is I-M438, also known as I2.
• All known living members descend from a common ancestor 6 times younger than the common ancestor with I2.[1]
• Before a reclassification in 2008,[22] the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).
• Contents
• 1 Origins
• 2 Structure
• 3 Historical expansion
• 4 Geographical distribution
• 5 Prominent members of I-M253
• 6 Markers
• 7 See also
• 8 References
• 9 Further reading
• 9.1 External links
• Origins
• Map of the early Nordic Bronze Age, where I1 first became prominent. The Nordic Bronze Age is often considered ancestral to the Germanic peoples.
• While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the Gravettian, so far DNA studies have only been able to locate it in one Mesolithic hunter-gatherer. As of April 2021, only 4 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:
• The first is a DNA sample from a Scandinavian hunter-gatherer with the label SF11 found on Stora Karlsö on Gotland. SF11 was found to have carried 9 of the 312 SNPs that define haplogroup I1. SF11 was classified as I1-Z2699*.[23][24][25][26] SF11 was not assigned to a specific archaeological culture due to the skeleton being found in the Stora Förvar cave on Stora Karlsö. The skeleton is dated to 5500 BC.
• The second is an individual sample labelled BAB5 from Neolithic Hungary.[27] BAB5 was found to have carried 1 of the 312 SNPs that define haplogroup I1. BAB5 may also be classified as I1-Z2699*.[28] BAB5 had a genetic affinity to other contemporary Neolithic farmers of Central Europe.
• Additionally, the third ancient I1 sample is from an individual found in a kurgan burial dating to the late Neolithic Dagger Period in Scandinavia labelled RISE179.[29] RISE179 had a genetic affinity to the populations of the Corded Ware culture and the Unetice culture.[30]
• The fourth ancient I1 sample predating the Nordic Bronze Age is labelled oll009 and was sequenced in the study titled "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon".[31] Oll009 is dated to the Scandinavian late Neolithic and was found in a burial in Sweden. Similar to RISE179, he carried a high percentage of Western Steppe-Herder ancestry and had a genetic affinity to the population of the Battle Axe culture and other populations of the Corded Ware horizon.[32]
• Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia.[33][34][35]Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying Western Steppe Herder ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age.[36][37][38]
• Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as Pitted Ware before becoming assimilated by the Battle Axe culture, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the Funnelbeaker culture in Central Europe. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.
• Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2570 BC.
• According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe.[2] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques.[3]
• In 2007, it was suggested that it initially dispersed from the area that is now Denmark.[14] However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower Elbe basin seems like the heartland of I1".
• Latest results (Sept. 2019) published by Y-Full suggest I1 (I-M253) was formed 27.500 ybp (95 CI: 29.800 ybp – 25.200 ybp) with TMRCA 4.600 ybp (95 CI: 5.200 ybp – 4.000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2570 BC, this likely puts the ancestor of all living I1 men somewhere in Central or Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion.[39][40] This suggests that I1 went from being a rare marker to a rather common one in a rapid burst.[41]
• Structure
• I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [6]
• I-DF29 (DF29/S438); I1a
• I-CTS6364 (CTS6364/Z2336); I1a1
• FGC20030; I1a1a~
• S4767; I1a1a1~
• I-M227; I1a1a1a1a
• A394; I1a1a2~
• Y11221; I1a1a3~
• A5338; I1a1a4~
• CTS10028; I1a1b
• I-L22 (L22/S142); I1a1b1
• CTS11651/Z2338; I1a1b1a~
• I-P109; I1a1b1a1
• I-Y3662; I1a1b1a1e~
• I-S14887; I1a1b1a1e2~
• I-Y11203; I1a1b1a1e2d~
• I-Y29630; I1a1b1a1e2d2~
• CTS6017; I1a1b1a2
• I-L205 (L205.1/L939.1/S239.1); I1a1b1a3
• CTS6868; I1a1b1a4
• I-Z74; I1a1b1a4a
• CTS2208; I1a1b1a4a1~
• I-L287; I1a1b1a4a1a
• I-L258 (L258/S335); I1a1b1a4a1a1
• I-L813; I1a1b1a4a2
• FGC12562; I1a1b1a4a3~
• CTS11603/S4744; I1a1b1b~
• I-L300 (L300/S241); I1a1b1b1a1
• FGC10477/Y13056; I1a1b2
• A8178, A8182, A8200, A8204; I1a1b3~
• F13534.2/Y17263.2; I1a1b4~
• I-Z58 (S244/Z58); I1a2
• I-Z59 (S246/Z59); I1a2a
• I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
• I-Z140 (Z140, Z141)
• I-L338
• I-F2642 (F2642)
• I-Z73
• I-L1302
• I-L573
• I-L803
• I-Z382; I1a2a2
• I-Z138 (S296/Z138, Z139); I1a2b
• I-Z2541
• I-Z63 (S243/Z63); I1a3
• I-BY151; I1a3a
• I-L849.2; I1a3a1
• I-BY351; I1a3a2
• I-CTS10345
• I-Y10994
• I-Y7075
• I-S2078
• I-S2077
• I-Y2245 (Y2245/PR683)
• I-L1237
• I-FGC9550
• I-S10360
• I-S15301
• I-Y7234
• I-BY62 (BY62); I1a3a3
• I-Z131 (Z131/S249); I1b
• I-CTS6397; I1b1
• I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c
• Historical expansion
• A timeline of the early Germanic expansions
• Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with Germanic peoples and are linked to the proto-Germanic speakers of the Nordic Bronze Age.[42][43] Current DNA research indicates that I1 was close to non-existent in most of Europe outside of Scandinavia and northern Germany before the Migration Period. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanics migrated across the Baltic Sea and settled alongside the Vistula. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the Goths.[44]
• I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. [45] The Kowalewko archeological site has been associated with the Wielbark culture. Therefore the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy.[46][47] The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.
• In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300-400 AD from Saxony-Anhalt in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe.[48]
• Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234.[49] Material findings associated with the Lombards have been excavated in Crypta Balbi.
• The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the Visigoths. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1.[50] This finding is in accordance with the common ancestral origin of the Visigoths and the Ostrogoths.
• The Anglo-Saxon settlement of Britain introduced I1 in the British Isles.[51]
• During the Viking Age, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia.[52]
• Geographical distribution
• I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking Age, or modern times. It is found in all places invaded by the Norse.
• During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia, New Zealand and Canada.
• Population Sample size I (total) I1 (I-M253) I1a1a (I-M227) Source
• Albanians (Tirana) 55 21.82%=(12/55) 3.6%=(2/55) 0.0 Battaglia et al. 2008
• Albanians (North Macedonia) 64 17.2%=(11/64) 4.7%=(3/64) 0.0 Battaglia et al. 2008
• Albanians (Tirana)
• Albanians (North Macedonia) 55+64=119 19.33%=(23/119) 4.2%=(5/119) 0.0 Battaglia et al. 2008
• Kosovo Albanians (Pristina) 114 7.96%=(9/114) 5.31%=(6/114) 0.0 Pericic et al. 2005
• Albanians (Tirana)
• Albanians (North Macedonia)
• Kosovo Albanians (Pristina) 55+64+114=233 13.73%=(32/233) 4.72%=(11/233) 0.0 Pericic et al. 2005
• Battaglia et al. 2008
• Austria 43 9.3 2.3 0.0 Underhill et al. 2007
• Belarus: Vitbsk 100 15 1.0 0.0 Underhill et al. 2007
• Belarus: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
• Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
• Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
• Czech Republic 47 31.9 8.5 0.0 Underhill et al. 2007
• Czech Republic 53 17.0 1.9 0.0 Rootsi et al. 2004
• Denmark 122 39.3% (48/122) 32.8% (40/122) 0.0 Underhill et al. 2007
• England 104 19.2 15.4 0.0 Underhill et al. 2007
• Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
• Estonia 118 11.9 Lappalainen et al. 2008
• Finland (national) 28.0 Lappalainen et al. 2006
• Finland: West 230 40% (92/230) Lappalainen et al. 2008
• Finland: East 306 19% (58/306) Lappalainen et al. 2008
• Finland: Satakunta region 50+ Lappalainen et al. 20089
• France 58 17.2 8.6 1.7 Underhill et al. 2007
• France 12 16.7 16.7 0.0 Cann et al. 2002
• France (Low Normandy) 42 21.4 11.9 0.0 Rootsi et al. 2004
• Germany 125 24 15.2 0.0 Underhill et al. 2007
• Greece 171 15.8 2.3 0.0 Underhill et al. 2007
• Hungary 113 25.7 13.3 0.0 Rootsi et al. 2004
• Ireland 100 11 6.0 0.0 Underhill et al. 2007
• Kazan Tatars 53 13.2 11.3 0.0 Trofimova 2015
• Latvia 113 3.5 Lappalainen et al. 2008
• Lithuania 164 4.9 Lappalainen et al. 2008
• Netherlands 93 20.4 14 0.0 Underhill et al. 2007
• Norway 1766 37% (653/1766) Stenersen et al 2006
• Russia (national) 16 25 12.5 0.0 Cann et al. 2002
• Russia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
• Russia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
• Russia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
• Russia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
• Russia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
• Russia: Cossacks 89 24.7 4.5 0.0 Underhill et al. 2007
• Russia: Karelians 140 10 8.6 0.0 Underhill et al. 2007
• Russia: Karelians 132 15.2 Lappalainen et al. 2008
• Russia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
• Slovakia 70 14.3 4.3 0.0 Rootsi et al. 2004
• Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
• Sweden (national) 160 35.6% (57/160) Lappalainen et al. 2008
• Sweden (national) 38.0 Lappalainen et al. 2009
• Sweden: Västra Götaland 52 Lappalainen et al. 2009
• Switzerland 144 7.6 5.6 0.0 Rootsi et al. 2004
• Turkey 523 5.4 1.1 0.0 Underhill et al. 2007
• Ukraine: Lviv 101 23.8 4.9 0.0 Underhill et al. 2007
• Ukraine: Ivanovo-Frankiv 56 21.4 1.8 0.0 Underhill et al. 2007
• Ukraine: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
• Ukraine: Cherkasy 114 28.1 4.3 0.0 Underhill et al. 2007
• Ukraine: Bilhorod 56 26.8 5.3 0.0 Underhill et al. 2007
• Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I1 to Anglo-Saxon mass migration into England, but not into Wales.
• In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[53] The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was
• that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.
• Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I-M253 is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)
• In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[54] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.
• Prominent members of I-M253
• Main article: List of haplogroups of historical and famous figures
• Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.[55]
• The Varangian Šimon, who was said to have been the founder of the Russian Vorontsov noble family, belonged to haplogroup I1-Y15024.[56][57] Testing by geneticist Peter Sjölund and FamilyTreeDNA showed that the present-day male members of the Vorontsov family still carry this subclade of I1, and downstream subclades.[58][59] Some prominent historical members of the Vorontsov family were Prince Mikhail Semyonovich Vorontsov, a Russian prince and field-marshal, as well as Count Illarion Ivanovich Vorontsov-Dashkov, a general of the Russian Empire.
• The Rurikid Prince Sviatopolk the Accursed (son of Vladimir the Great) was found to likely have carried the I1-S2077 subclade of I1-Z63.[60][61][62]
• Birger Jarl, 'Duke of Sweden' of the East Geatish House of Bjälbo, founder of Stockholm; his remains were exhumed and tested in 2002 and found to be I-M253.[63] The House of Bjälbo also provided three kings of Norway, and one king of Denmark in the 14th century.
• Sting was revealed to belong to haplogroup I1 by the PBS TV series Finding Your Roots.[64]
• William Bradford (governor) of the Mayflower, proven through the Mayflower DNA Project[65]
• William Brewster (Mayflower passenger) of the Mayflower, proven through the Mayflower DNA Project[65]
• General Robert E. Lee belonged to I-M253 based on DNA testing of his descendants as a part of the Lee DNA Project. Other prominent members of the Lee family of Virginia and Maryland were Richard Lee I and Richard Henry Lee. The latter was one of the Founding Fathers of the United States of America.[66]
• Robert I of Scotland, commonly known as Robert the Bruce, belonged to haplogroup I1. Descendant testing of Robert, 6th lord of Annandale de Brus, assigned the men of Clan Bruce to I1-Y17395.[67]
• The male members of the House of Grimaldi were revealed to carry haplogroup I1 as a part of the Grimaldi Genealogy DNA project.[68] They were lords and princes of Monaco up until 1949. The men of House Grimaldi belong to a Scandinavian subclade of I1, downstream of I1-Y3549.
• President Andrew Jackson belonged to haplogroup I1, based on results from the Jackson DNA project and from genealogy.[69][70]
• The Russian writer Leo Tolstoy was found to have carried I1. The testing of his male descendant Pyotr Tolstoy revealed that the males of the Tolstoy family carry I1-M253.[71][72]
• Snorri Sturluson was found to likely have belonged to haplogroup I1. Y-DNA testing of his presumed descendants revealed an assignment to I-M253. Their results are available on YSearch.org.[71]
• The Swedish scientist and theologian Emanuel Swedenborg and other male members of the Swedenborg noble family were found to belong to haplogroup I1-BY229, as a part of the I1-L1302 DNA project by Jakob Norstedt.[73][74]
• Siener van Rensburg, Boer patriotic figure and mystic, belonged to haplogroup I1.[75][76]
• Björn Wahlroos, Finnish businessman and millionaire, was found to belong to haplogroup I1.[71]
• The Finnish mathematician Rolf Nevanlinna belonged to I1-M253 based on the testing of his son Arne Nevanlinna by Geni.com.[77][78][79]
• Samuel Morse was found to have carried haplogroup I1 as a part of the Morse DNA project.[80][81][82]
• Footballers Sebastian Larsson and his father Svante Larsson were found to belong to I1-Y24470 through the testing of a family member.[83][84][85][86]
• Felix Kjellberg (PewDiePie) was found to belong to haplogroup I1-L22, according to testing by 23andMe.[87]
• Swedish actor Björn Andrésen belongs to haplogroup I1-L22 based on the ftDNA and 23andMe tests of one of his first cousins and one uncle on the paternal side as a part of their family research.[88][89][90][91]Their ancestor Johan Andrésen lived on both sides of the Swedish-Norwegian border.[92][93]
• As a part of the Pine family DNA project, actor Chris Pine was found to belong to haplogroup I1-A13819.[94][95]
• Markers
• DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).
• The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.
• Name: M253[96]
• Type: SNP
• Source: M (Peter Underhill of Stanford University)
• Position: ChrY:13532101..13532101 (+ strand)
• Position (base pair): 283
• Total size (base pairs): 400
• Length: 1
• ISOGG HG: I1
• Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
• Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
• YCC HG: I1
• Nucleotide alleles change (mutation): C to T
• Name: M307[97]
• Type: SNP
• Source: M (Peter Underhill)
• Position: ChrY:21160339..21160339 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: TTATTGGCATTTCAGGAAGTG
• Primer R: GGGTGAGGCAGGAAAATAGC
• YCC HG: I1
• Nucleotide alleles change (mutation): G to A
• Name: P30[98]
• Type: SNP
• Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)
• Position: ChrY:13006761..13006761 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: GGTGGGCTGTTTGAAAAAGA
• Primer R: AGCCAAATACCAGTCGTCAC
• YCC HG: I1
• Nucleotide alleles change (mutation): G to A
• Region: ARSDP
• Name: P40[99]
• Type: SNP
• Source: PS (Michael Hammer and James F. Wilson)
• Position: ChrY:12994402..12994402 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: GGAGAAAAGGTGAGAAACC
• Primer R: GGACAAGGGGCAGATT
• YCC HG: I1
• Nucleotide alleles change (mutation): C to T
• Region: ARSDP
• See also
• European ethnic groups
• Genetic history of Europe
• Germanic peoples
• History of Normandy
• Human Y-chromosome DNA haplogroups
• Late Glacial Maximum
• Neolithic Europe
• Norse colonization of the Americas
• Norse Sagas
• References
• https://yfull.com/tree/I1/
• Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
• Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6: 7152. doi:10.1038/ncomms8152. PMC 4441248. PMID 25988751.
• Rootsi S, Magri C, Kivisild T, Benuzzi G, Help H, Bermisheva M, et al. (July 2004). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe" (PDF). American Journal of Human Genetics. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323. Archived from the original (PDF) on 2009-06-24. Retrieved 2008-03-20.
• P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.
• ISOGG, Y-DNA Haplogroup I and its Subclades – 2017 (31 January 2017).
• Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
• Lappalainen T, Hannelius U, Salmela E, von Döbeln U, Lindgren CM, Huoponen K, et al. (January 2009). "Population structure in contemporary Sweden--a Y-chromosomal and mitochondrial DNA analysis". Annals of Human Genetics. 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID 19040656. S2CID 205598345.
• https://www.familytreedna.com/public/Sweden?iframe=ymap
• Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
• Dupuy BM, Stenersen M, Lu TT, Olaisen B (December 2006). "Geographical heterogeneity of Y-chromosomal lineages in Norway". Forensic Science International. 164 (1): 10–9. doi:10.1016/j.forsciint.2005.11.009. PMID 16337760.
• "FamilyTreeDNA - The Norway DNA Project - Norgesprosjektet". www.familytreedna.com. Retrieved 2020-11-26.
• "Y-DNA Haplogrupper". Norway DNA Norgesprosjektet. Retrieved 2020-12-27.
• Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
• Sanchez JJ (2004). "Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis" (PDF). International Congress Series. 1261: 347–349. doi:10.1016/S0531-5131(03)01635-2 – via isfg.org.
• "FamilyTreeDNA - Denmark DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland". The American Journal of Human Genetics. 67 (3): 697–717. 2000-09-01. doi:10.1086/303046. ISSN 0002-9297.
• "The Greater Nordic Regional Y-DNA Project". familytreedna. April 2021.
• Ebenesersdóttir, S. Sunna; Sandoval-Velasco, Marcela; Gunnarsdóttir, Ellen D.; Jagadeesan, Anuradha; Guðmundsdóttir, Valdís B.; Thordardóttir, Elísabet L.; Einarsdóttir, Margrét S.; Moore, Kristjan H. S.; Sigurðsson, Ásgeir; Magnúsdóttir, Droplaug N.; Jónsson, Hákon (2018-06-01). "Ancient genomes from Iceland reveal the making of a human population". Science (New York, N.Y.). 360 (6392): 1028–1032. doi:10.1126/science.aar2625. ISSN 1095-9203. PMID 29853688.
• Lappalainen T., Koivumäki S., Salmela E., Huoponen K., Sistonen P., Savontaus M.L., Lahermo P.; 2006, "Regional differences among the Finns: a Y-chromosomal perspective", Gene vol. 376, no. 2, pp. 207–15.
• "Blood of the Isles: exploring the genetic roots of our tribal history". History Ireland. 2013-02-22. Retrieved 2020-12-10.
• Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (May 2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
• Gunther T (2017). "Genomics of Mesolithic Scandinavia reveal colonization routes and high-latitude adaptation" (PDF). Nature. 23: 6 – via Biorxiv.
• SF11 - Stora Förvar, Stora Karlsö I-Z2699*. "Haplotree.info sample: SF11". haplotree.info.
• Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014). "Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers". Science. 344 (6185): 747–50. Bibcode:2014Sci...344..747S. doi:10.1126/science.1253448. PMID 24762536. S2CID 206556994.
• "familytreedna.com I-Z2699 tree". familytreedna. April 2021.
• Szécsényi-Nagy A, Brandt G, Haak W, Keerl V, Jakucs J, Möller-Rieker S, et al. (April 2015). "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". Proceedings. Biological Sciences. 282 (1805). doi:10.1098/rspb.2015.0339. PMC 4389623. PMID 25808890.
• 5&ybp=500000,0 "BAB5 I-Z2699*" Check |url= value (help). haplotree.info.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• "YFull | The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". www.yfull.com. Retrieved 2021-01-24.
• Malmstrom H (July 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" (PDF). Uppsala Genomics. 1: 3 – via jakobssonlab.iob.uu.se/.
• Sánchez-Quinto F, Malmström H, Fraser M, Girdland-Flink L, Svensson EM, Simões LG, et al. (May 2019). "Megalithic tombs in western and northern Neolithic Europe were linked to a kindred society". Proceedings of the National Academy of Sciences of the United States of America. 116 (19): 9469–9474. doi:10.1073/pnas.1818037116. PMC 6511028. PMID 30988179.
• Malmström H, Linderholm A, Skoglund P, Storå J, Sjödin P, Gilbert MT, et al. (January 2015). "Ancient mitochondrial DNA from the northern fringe of the Neolithic farming expansion in Europe sheds light on the dispersion process". Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 370 (1660): 20130373. doi:10.1098/rstb.2013.0373. PMC 4275881. PMID 25487325.
• Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014). "Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers". Science. 344 (6185): 747–50. Bibcode:2014Sci...344..747S. doi:10.1126/science.1253448. PMID 24762536. S2CID 206556994.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• Karlsson AO, Wallerström T, Götherström A, Holmlund G (August 2006). "Y-chromosome diversity in Sweden - a long-time perspective". European Journal of Human Genetics. 14 (8): 963–70. doi:10.1038/sj.ejhg.5201651. PMID 16724001. S2CID 23227271.
• Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
• Poznik GD, Xue Y, Mendez FL, Willems TF, Massaia A, Wilson Sayres MA, et al. (June 2016). "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics. 48 (6): 593–9. doi:10.1038/ng.3559. hdl:11858/00-001M-0000-002A-F024-C. PMC 4884158. PMID 27111036.
• Woodley M (February 2017). "Holocene selection for variants associated with cognitive ability: Comparing ancient and modern genomes" (PDF). www.biorxiv.org/. doi:10.1101/109678. S2CID 196631764. Retrieved 27 January 2021.
• Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6: 7152. Bibcode:2015NatCo...6.7152B. doi:10.1038/ncomms8152. PMC 4441248. PMID 25988751.
• Schmidt KH (1991). "The Celts and the Ethnogenesis of the Germanic People". Historische Sprachforschung / Historical Linguistics. 104 (1): 129–152. ISSN 0935-3518. JSTOR 40849016.
• Bergerbrant S (May 2007). "Bronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BC" (PDF). Stockholm Studies in Archaeology. 43: 7–201 – via diva-portal.org.
• Teska M, Michalowski A (2014). "Connection between Wielkopolska and the Baltic Sea Region in the Roman Iron Age". www.semanticscholar.org. S2CID 56295624. Retrieved 2020-12-10.
• Zenczak M, Handschuh L, Juras A, Marcinkowska-Swojak M, Philips A, Piontek J, Stolarek I, Figlerowicz M (2017). Y-Chromosome Haplogroup Assignment Through Next Generation Sequencing of Enriched Ancient DNA Libraries. Anthropological Genetics. p. Presentation number: AG 16.
• Amorim CE, Vai S, Posth C, Modi A, Koncz I, Hakenbeck S, et al. (September 2018). "Understanding 6th-century barbarian social organization and migration through paleogenomics". Nature Communications. 9 (1): 3547. Bibcode:2018NatCo...9.3547A. doi:10.1038/s41467-018-06024-4. PMC 6134036. PMID 30206220.
• Estes R (2020-10-16). "Longobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?". DNAeXplained - Genetic Genealogy. Retrieved 2020-12-11.
• Labudde D (July 2015). "Gender distribution of excavation finds from the Roman imperial and migration period". ResearchGate. 1: 2 – via ResearchGate.net.
• Antonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, et al. (November 2019). "Ancient Rome: A genetic crossroads of Europe and the Mediterranean". Science. 366 (6466): 708–714. Bibcode:2019Sci...366..708A. doi:10.1126/science.aay6826. PMC 7093155. PMID 31699931.
• Olalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, et al. (March 2019). "The genomic history of the Iberian Peninsula over the past 8000 years". Science. 363 (6432): 1230–1234. Bibcode:2019Sci...363.1230O. doi:10.1126/science.aav4040. PMC 6436108. PMID 30872528.
• Martiniano R, Caffell A, Holst M, Hunter-Mann K, Montgomery J, Müldner G, et al. (January 2016). "Genomic signals of migration and continuity in Britain before the Anglo-Saxons". Nature Communications. 7 (1): 10326. Bibcode:2016NatCo...710326M. doi:10.1038/ncomms10326. PMC 4735653. PMID 26783717.
• Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–396. doi:10.1101/703405. PMID 32939067. S2CID 201195157.
• Weale ME, Weiss DA, Jager RF, Bradman N, Thomas MG (July 2002). "Y chromosome evidence for Anglo-Saxon mass migration". Molecular Biology and Evolution. 19 (7): 1008–21. doi:10.1093/oxfordjournals.molbev.a004160. PMID 12082121.
• Capelli C, Redhead N, Abernethy JK, Gratrix F, Wilson JF, Moen T, et al. (May 2003). "A Y chromosome census of the British Isles". Current Biology. 13 (11): 979–84. doi:10.1016/S0960-9822(03)00373-7. PMID 12781138. S2CID 526263.
• "Founding Father DNA". isogg.org.
• "FamilyTreeDNA - Genetic Testing for Ancestry, Family History & Genealogy". www.familytreedna.com. Retrieved 2020-12-10.
• "Faderslinjen, DNA". www.sikaby.se. Retrieved 2020-12-10.
• "FamilyTreeDNA - RussiaDNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Vår vikingahövding i österled". www.sikaby.se. Retrieved 2020-12-10.
• "Sample from Homo sapiens - BioSample - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-10.
• Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–396. Bibcode:2020Natur.585..390M. doi:10.1038/s41586-020-2688-8. PMID 32939067.
• Duczko W (2004-01-01). Viking Rus: Studies on the Presence of Scandinavians in Eastern Europe. BRILL. ISBN 978-90-04-13874-2.
• Malmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MT, et al. (January 2012). "Finding the founder of Stockholm - a kinship study based on Y-chromosomal, autosomal and mitochondrial DNA". Annals of Anatomy = Anatomischer Anzeiger. Special Issue: Ancient DNA. 194 (1): 138–45. doi:10.1016/j.aanat.2011.03.014. PMID 21596538.
• The British Invasion Finding Your Roots
• "Mayflower DNA Project". mayflowerdna.org. Retrieved 2020-11-23.
• "FamilyTreeDNA - Lee Surname DNA Research Project (and Leigh, Lea, etc)". www.familytreedna.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - I1-S4795". www.familytreedna.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - GRIMALDI GENEALOGY PROJECT at FtDNA". www.familytreedna.com. Retrieved 2020-12-11.
• "Jackson DNA Project". FamilyTreeDNA. 11 December 2020.
• Hay M (July 2020). "Origins and history of Haplogroup I1 (Y-DNA)". ResearchGate. 1: 9.
• Maciamo E. "Haplogroup I1 (Y-DNA)". Eupedia. Retrieved 2020-12-11.
• Петр Толстой. Моя родословная. Выпуск от 18.04.2010 (in Russian), retrieved 2020-12-15
• "I-BY229 YTree". yfull.com. Retrieved 2020-12-10.
• "Swedenborg". Höijen (in Swedish). Retrieved 2020-12-10.
• "Claas Jansz van Rensburg, SV/PROG". geni_family_tree. Retrieved 2021-01-03.
• "janse /jansen van Rensburg I-M253 genealogy discussion". geni_family_tree. Retrieved 2021-01-03.
• "Rolf H. Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
• olenus (2018-03-30). "I1: Rolf Nevanlinna (né Neovius)". Descendants of haplogroup IJ-M429. Retrieved 2020-12-26.
• "Arne Edvard Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
• "Morse/Moss DNA Testing". morsesociety.org. Retrieved 2020-12-10.
• "FamilyTreeDNA - Morse / Moss DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Peter Morse's Family Tree". www.geni.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - Sweden DNA PROJECT - Sverigeprojektet". www.familytreedna.com. Retrieved 2021-02-14.
• "Eskilstuna kommun · EM GN398 - Familjen Larsson, Torshälla ca 1900". Eskilstuna kommun (in Swedish). Retrieved 2021-02-14.
• "I-Y24470 YTree". www.yfull.com. Retrieved 2021-02-14.
• "Familjen Larssons Anfäder". hosserudkullen.se. Retrieved 2021-02-14.
• https://www.youtube.com/watch?v=sLJ9my42vR4
• "FamilyTreeDNA - The Norway DNA Project - Norgesprosjektet". www.familytreedna.com. Retrieved 2021-02-02.
• Tovseth A (June 2018). "Andrésen, Färnskog & Hansen family research". Kjellivar.tripod.com. Retrieved 2 February 2021.
• "Personer med namnet Andresen | Släktingar.se". www.slaktingar.se. Retrieved 2021-02-02.
• "BJÖRN ANDRESEN: Min passion för mamma blev aldrig besvarad - Katarina Hahr möter". Radio Sveriges (in Swedish). Retrieved 2021-02-02.
• "Johan Peter Andresen - Ancestry". www.ancestry.se. Retrieved 2021-02-02.
• "Family tree of Daniel ANDRESEN". Geneanet. Retrieved 2021-02-02.
• "FamilyTreeDNA - Pine/Pyne Genealogy DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "James Pine, Sr". geni_family_tree. Retrieved 2020-12-10.
• snpdev. "Reference SNP (refSNP) Cluster Report: rs9341296". nih.gov.
• snpdev. "Reference SNP (refSNP) Cluster Report: rs13447354". nih.gov.
• P30[permanent dead link]
• P40[permanent dead link]
• Further reading
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. doi:10.1038/nature14507. PMID 26062507.
• Brunel S, Bennett EA, Cardin L, Garraud D, Barrand Emam H, Beylier A, et al. (June 2020). "Ancient genomes from present-day France unveil 7,000 years of its demographic history". Proceedings of the National Academy of Sciences of the United States of America. 117 (23): 12791–12798. doi:10.1073/pnas.1918034117. PMC 7293694. PMID 32457149.</ref>
• Malmström H, Gilbert MT, Thomas MG, Brandström M, Storå J, Molnar P, et al. (November 2009). "Ancient DNA reveals lack of continuity between neolithic hunter-gatherers and contemporary Scandinavians". Current Biology. 19 (20): 1758–62. doi:10.1016/j.cub.2009.09.017.
• Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, Pospieszny Ł, Tõrv M, Lindström J, Götherström A, Storå J, Jakobsson M (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
• Villalba-Mouco V, van de Loosdrecht MS, Posth C, Mora R, Martínez-Moreno J, Rojo-Guerra M, et al. (April 2019). "Survival of Late Pleistocene Hunter-Gatherer Ancestry in the Iberian Peninsula". Current Biology. Cell Press. 29 (7): 1169–1177.e7. doi:10.1016/j.cub.2019.02.006. PMID 30880015. S2CID 76663708.
• External links
• Haplogroup I databases
• Haplogroup I1 Project at FTDNA
• Danish Demes Regional DNA Project at FTDNA
• Haplogroup I-P109 Project
• British Isles DNA Project
• General Y-DNA databases
• There are several public access databases featuring I-M253, including:
• http://www.ysearch.org/
• http://www.yhrd.org/
• http://www.yfull.com/ tree/I1/

• В человеческой генетике,Haplogroup I1 (M253) Гаплогруппа I1 (бывшая I1a) (M253, M307.1/P203.1, M450/S109, P30, P40, S62, S63, S64, S65, S66, S107, S108, S110, S111) — Y-хромосомная гаплогруппа, типичная для популяций Скандинавии и северо-западной Европы, с умеренным распределением всюду по Восточной Европе.
• Содержание
• 1 Происхождение
• 2 Палеогенетика
• 2.1 Мезолит
• 2.2 Неолит
• 2.3 Бронзовый век
• 2.4 Железный век
• 2.5 Средние века
• 3 Субклады[12]
• 4 Распространение
• 5 Известные люди
• 6 Примечания
• 7 Ссылки
• 8 Дерево гаплогрупп Y-ДНК человека
• Происхождение
• Гаплогруппа I1 происходит от мутации гаплогруппы I, произошедшей у мужчины, жившего ок. 27 500 лет назад. Последний общий предок современных носителей гаплогруппы I1 жил 4 600 лет назад (даты определены по снипам компанией YFull[1]).
• Гаплогруппа I1 является коренной европейской гаплогруппой[2]. Большинство современных носителей гаплогруппы I1 составляют носители германских языков индоевропейской семьи, хотя первоначально данная гаплогруппа была связана, по-видимому, не с индоевропейскими народами, а с догерманским субстратом.
• I1 имеет три основные субклады: I1a1 (CTS6364), I1a2 (Z58), I1a3 (Z63). Субветвь I1a1b3a1 (L258) или I1d-Bothnia (ранее) характерна для финнов, I1a3 (Z63) — для Восточной Европы.
• I1 идентифицируется по меньшей мере 300 уникальными мутациями, что означает, что данная группа либо была совершенно изолирована в течение долгого периода (что маловероятно), либо пережила серьёзное «бутылочное горлышко» в сравнительно недавнем времени. Хотя первая мутация, отделившая I1 от I, могла произойти ещё 20 тысячелетий назад, все сегодняшние носители этой гаплогруппы происходят от одного мужчины, жившего не раньше, чем 5 тысячелетий назад. Это вполне совпадает со временем прихода в Скандинавию индоевропейцев, которые, как предполагается, уничтожали большую часть мужчин коренного населения или ставили их семьи в невыгодное демографическое положение. Так что выглядит вполне правдоподобным, что это вторжение пережил лишь один род коренных доиндоевропейских скандинавов (или, например, возможно, один мальчик), потомки которого в дальнейшем и составили гаплогруппу I1, которая таким образом стала достоверной меткой скандинавского протогерманского этноса, складывавшегося в ту эпоху. Сегодня представителей этой группы находят всюду, куда имели место вторжения или миграции древних германцев — например, на севере европейской части России (Карелия, Вологда), куда, вероятно, I1 передалась через скандинавов.[3]
• Палеогенетика
• Мезолит
• Гаплогруппа I1 была обнаружена у мезолитического обитателя острова Стура-Карлсё (Лен Готланд, Швеция)[4].
• Неолит
• Гаплогруппа I1 была обнаружена у представителя культуры линейно-ленточной керамики (неолит Венгрии), жившего ок. 7000 лет назад[5][6].
• Бронзовый век
• Как минимум два представителя бронзового века Швеции имели гаплогруппу I1 (Angmollan, 1493—1302 года до н. э.)[7].
• Железный век
• Представитель Вельбарской культуры (Польша), живший примерно в 100—300 году н. э., имел гаплогруппу I1[8].
• Средние века
• Англосакс, живший примерно в 550—650 год н. э. и похороненный в Северной Британии, имел гаплогруппу I1[9].
• Мужчина из захоронения Лангобардов в западной Венгрии, живший примерно в 600—650 год н. э., имел гаплогруппу I1[10].
• Представитель средневековой Польши, живший примерно в 1000—1200 год н. э., имел гаплогруппу I1 (захоронен вместе с оружием и ценными вещами)[8]
• Гаплогруппа I1 была обнаружена в шести образцах из средневекового захоронения в Исландии. Субклады: I1a2a1a2-F2642, I1b-Z131, I1-M253, I1a1b3b-L813, I1a1b3-Z74, I1-M253.[11].
• Субклады[12]
• Z131 + является небольшим субкладом, который был найден в районах, граничащих с древней кельтско-германской границей (Бельгия, Центральная Германия, Богемия), также обнаружен в Швеции и Великобритании.
• Z17925 + небольшой субклад, который можно найти в Германии, Франции и Англии.
• Z19086 + является небольшим субкладом, найденным в Финляндии.
• DF29 + представляет 99% линий I1.
• • CTS6364 + основной северный субклад, вероятно скандинавского происхождения.
• • • Y3866 + встречается в основном в Скандинавии.
• • • • A5338 + встречается чаще всего в Норвегии, но также был найден в Шотландии.
• • • • S11221 + встречается чаще всего в Швеции и Норвегии, но также найдена в Венгрии.
• • • • S4767 + образовался около 4000 лет назад.
• • • • • Y4781 + встречается в основном в скандинавских странах.
• • • • • • M227 + встречается почти во всех странах Европы, и даже на Ближнем Востоке.
• • • • • S7642 + встречается в основном в Швеции.
• • • • • • Y18103 + встречается в основном в Польше.
• • • L22 + (aka S142 +) — очень большая скандинавская ветвь. Имеет очень большое распространение в Великобритании, особенно на восточном побережье, где селились датские викинги, а также в Польше и России (шведские викинги). L22 (I1a1b) характерна для части башкир-сары-мингов и башкир-юрматов
• • • • P109 + В основном южный скандинавский субклад, с присутствием во всех регионах, куда мигрировали датские викинги. Он был обнаружен во многих частях Европы, таких как западная Иберия, северная Италия, Балканы, Литва и Россия.
• • • • • S10891 + встречается в основном в Швеции и Норвегии, но также в Нормандии и Британских островах (происхождение — викинги), а также в северной Италии (субклад FGC21732).
• • • • • S7660 / Y3662 +
• • • • • • Y4045 + находится в Англии и Ирландии (происхождение — викинги).
• • • • • • S14887 + встречается в основном в Дании, Швеции и Финляндии.
• • • • • • • FGC22045 + является основным субкладом I1, найденным в на Балканах. Вероятно, норманнского происхождения.
• • • • • Y3664 + незначительный субклад, найденный в Дании, Шлезвиг-Гольштейне, Нормандии и Гернси (происхождение — викинги).
• Y5621 + — незначительная клада, найденная в Швеции, Нормандии, Великобритании и России (происхождение викингов).
• Y14999 + — незначительная клада, найденная во Франции и Великобритании.
• L205 + в основном ограничивается Нидерландами, Францией и Великобританией. Отдельные случаи были также выявлены в Швеции и Испании.
• L287 + является подавляющим финским подклассом (в целом по всей стране), с очень небольшим присутствием в Норвегии, Швеции, Польше и России.
• L300 + — это небольшой субклад, который встречается почти исключительно на юге Финляндии.
• L813 + является преимущественно скандинавским субкладом, особенно распространенным в южной Норвегии, но также найденным в Швеции и в меньшей степени западной Финляндией. Он также встречается в Великобритании (вероятно, спуск викингов) и в северных Нидерландах (но не в Германии).
• Z58 + преимущественно западногерманский, с очень сильным присутствием в Германии, странах с низким и британским. Он также находится в меньшей степени в скандинавских странах и во всей континентальной Европе. Его возраст оценивался приблизительно за 4600 лет до настоящего времени.
• Z138 + (aka Z139 +) — очень разрозненный субклад. Он встречается на очень низкой частоте во всем германском мире, с пиком в Англии и Уэльсе (хотя это может быть просто из-за передискретизации в Британии). Помимо германских стран, он также был найден в Ирландии, Португалии, на юге Италии, Венгрии и Румынии. Z138 + соответствует AS2, AS10, AS1010.2, AS10910, AS1221, AS1414 и Esc-13 в номенклатуре STR на основе FTDNA. Z138 разделен на четыре подклада: S2293 (самый большой), S5619, PF1610 и PF2364.
• S2293 + был образован 4500 лет назад и сразу же разделен на две ветви: S6277 и Z2541. S6277 + находится в Скандинавии, Великобритании, Франции, Германии, Австрии и Италии (Турин, Матера, Реджо-ди-Калабрия).
• Z2541 + соответствует AS1313 в номенклатуре STR на основе FTDNA. Это относительно небольшая клада, распространенная особенно на северо-западе Европы, но также на западе Украины, Румынии и Португалии. Он появился 4,500 лет назад, но имеет TMRCA 3800 лет. Он имеет пять подкладок:
• S2268 + находится в Ирландии, Великобритании, Нидерландах, Германии, Дании, Норвегии, Австрии и Венгрии.
• S19185 + находится в Великобритании, Ирландии, Норвегии и Венгрии.
• Y7043 + — самый большой из субкладов Z2541. Он находится в Норвегии на севере Италии (возможно, Ломбардская связь) через Германию, Бельгию и Швейцарию.
• Y21391 + был найден в Люксембурге. Y29668 + — небольшая клада, найденная в Англии.
• Z59 + является главной ветвью Z58.
• Z2040 + сформировался 4300 лет назад и разбился на две клады около 3900 лет назад. Образцы, отрицательные для L1450 и Z382, были найдены в Норвегии, Финляндии и России.
• L1450 + — небольшая клада, разбросанная по Норвегии, Германии, Польше, Болгарии, Словении, Швейцарии, Великобритании и Ирландии.
• Z382 + распространен особенно на Британских островах и в Германии, с незначительным присутствием в Скандинавии. Отдельные образцы были также идентифицированы в Финляндии, Нидерландах, Франции, Италии, Хорватии и Румынии. Соответствует AS3, AS3-911, AS13 и Sw в номенклатуре STR на основе FTDNA.
• S26361 + встречается в основном в Швеции и Норвегии.
• S16414 + был найден в Норвегии и на Сардинии (YP5417 +, TMRCA 1750 ybp), где он мог быть принесен вандалами.
• Y2170 + находится в Германии, Великобритании, Скандинавии и России. Y5384 + находится в Финляндии и Италии (Рим).
• Z60 + встречается во всем германском мире
• Y12342 + — небольшая клада, найденная в основном в Финляндии, но также и в Англии.
• Y22033 + — незначительная клада, найденная в Шотландии.
• Z140 + является явно западногерманским подкладом, который был найден в основном на Британских островах, Нидерландах (одна треть всех I1), северной Франции, центральной и южной Германии и Швейцарии. В скандинавских странах очень редок. Изолированные образцы были найдены в Испании, центральной и южной Италии, Словении, Чехии, Польше, Украине и России. Z140 * соответствует гаплотипам AS5, AS6, AS814 и EE в номенклатуре STR на основе FTDNA. I1-Z140 характерна для башкир-мурзалар (улаште) и тырнаклинцев, части кудейцев. Башкирские линии I1-Z140 отделились от европейских линий I1-Z140 более 2 тыс. лет назад.
• A196 + находится в Швеции, Германии, Швейцарии, Австрии, Венгрии, Франции, Португалии, Англии, Уэльсе, Шотландии, Ирландии, Беларуси и России.
• A1605 + — небольшая клада, найденная в Нидерландах и Великобритании. BY477 / Y15150 + — небольшая клада, найденная в Германии, Великобритании, Ирландии, Португалии и Испании.
• CTS8691 / F2642 / S2169 + — большая клада, особенно в Скандинавии, Германии и Великобритании, но также в Финляндии, Нидерландах, Швейцарии, Польше и Ирландии.
• Y6232 + находится в Центральной Европе, Великобритании и Италии.
• Y7277 + можно найти в Германии, Нидерландах, Англии, Чехии, Швейцарии и Италии. Этот субклад может быть связан с лангобардами.
• Y10890 + встречается особенно в центральной и южной Италии недалеко от мест, расположенных на Ломбардах (Ортона, Алифае, Кампобассо) и Вандалах (Трапани).
• Z2535 + — очень большая клада, найденная в Скандинавии, Великобритании, Германии, Чехии, Польше и Румынии.
• L338 + — большой субклад, найденный в Германии, Нидерландах, Норвегии, Великобритании, Швейцарии, Польше и Румынии. Обычно он имеет значение STR GATA-H4 = 9.
• L338 + делится на несколько подкладок, которые соответствуют AS1, AS1H, AS8, AS114 и AS11616 в номенклатуре STR на основе FTDNA.
• Z73 + (и L1301 +) главным образом северный скандинавский и финский. Он также встречается в России, на восточном побережье Великобритании и на шотландских островах (наследие викингов). Z73 + соответствует AS9 и AS16 в номенклатуре STR на основе FTDNA.
• L1302 + встречается главным образом в Швеции, с несколькими субкладами в Финляндии и Норвегии (BY495) и несколькими отдельными образцами, отобранными в Шотландии и России.
• L573 +, по-видимому, является главным образом северо-восточным германским подкладом, но он также был найден в Бельгии, Франции, Швеции, Польше, Литве и на северо-западе России.
• L1248 + является второстепенным подкладом, который был найден в Швеции, Великобритании, Германии и России.
• L803 + был идентифицирован только в Шотландии.
• Z63 + является сильно континентальным германским подкладом, практически отсутствующим в скандинавских странах. Это наиболее распространено в Центральной Германии, Бенилюксе, Англии, Нижней Шотландии, а также в Польше. Он также был найден в России, на Украине, на Балканах, в Италии, Испании и Португалии.
• S2078 + — широко распространенная клада, найденная в большинстве стран Европы, но относительно редко встречается в скандинавских странах, в Бенилюксе и на Британских островах.
• Y2245.2 + / PR683 составляет большую часть Z63 в России, Украине, Польше, на Балканах, в Италии и в Иберии. Он также находится в Великобритании, Швеции, Франции, Германии, Чехии, Боснии, Албании и Ливане. Некоторые субклады могли быть распространены готами.
• L1237 + находится в Швеции, Польше, Украине, России, Сербии, Боснии, Чехии, Франции и на севере Италии. Может быть готического происхождения. Подклас A8249 встречается главным образом в Великобритании, в то время как очень молодой (850 ybp) подклассу Y8815 находится исключительно в Шотландии.
• Y3968 + / S10360 + находится в Скандинавии, Финляндии, Германии, Англии, Польше, Украине, России, Венгрии, Италии, Испании и Португалии. Не только готика, но, несомненно, найден среди готов.
• Y7234 + / FGC14480 + находится в Польше, Германии, Бельгии, Франции и Испании.
• S2097 / Y4102 +> FGC29230 + встречается особенно в Испании (Каталония, Мадрид, Эстремадура) и Италии (Ломбардия, Сицилия), но и в Германии. Может быть готического происхождения.
• Y6375 + находится в Великобритании.
• Y16435 + находится в Сербии (второй наиболее распространенный подкласс после FGC22045).
• Y24458 + V68 + находится в Беларуси, Сербии и Косово.
• BY351 + — это подкласс, который можно найти в Польше, Украине, Хорватии, Италии (включая Сардинию), Франции, Испании и Португалии. Вероятно, он было распространен вестготами и остготами.
• Распространение
• Наиболее высокие частоты I1 обнаружены в Скандинавии. Анализ генетического разнообразия указывает на территорию современной Дании и Северной Германии как на место происхождения предка I1[13].
• В регионах России до 18 % (Roewer 2008) носителей гаплогруппы I1. Вероятно, что они представляют собой потомков дофинского и доиндоевропейского населения прибалтийского региона; также возможно, что это потомки скандинавских или германских переселенцев, а также потомки ассимилированных остготов, проживавших в Крыму с IV века н. э.
• Частоты гаплогруппы I1 в европейской части России.
• Популяция Частота Публикация
• Вологодская обл. 18 % (Roewer 2008)
• Архангельск 14,2 % (Mirabal 2009)
• Рязанская обл. 14 % (Roewer 2008)
• Казанские татары 13,2 % (Trofimova 2015[14])
• Красноборск (Арханг.) 12,1 % (Balanovsky 2008)
• Мокша 12 % (Rootsi 2004)*
• Вологда 11,6 % (Balanovsky 2008)
• Унжа (Костр.) 11,5 % (Balanovsky 2008)
• Кострома 11,3 % (Underhill 2007)*
• Пензенская обл. 11 % (Roewer 2008)
• Ивановская обл. 10 % (Roewer 2008)
• Тамбовская обл. 10 % (Roewer 2008)
• Карелы 8,6 % (Underhill 2007)
• Ливны (Орл.) 8,2 % (Balanovsky 2008)
• Тверь 7,9 % (Mirabal 2009)
• Архангельск 7,6 % (Underhill 2007)
• Чуваши 7,5 % (Rootsi 2004)
• Архангельская обл. 7 % (Roewer 2008)
• Брянская обл. 7 % (Roewer 2008)
• Остров (Пск.) 6,7 % (Balanovsky 2008)
• Костромская обл. 6 % (Rootsi 2004)
• Псков 5,4 % (Underhill 2007)
• Русские Адыгеи 5,1 % (Rootsi 2004)
• Тверская обл. 5 % (Roewer 2008)
• Курск 5 % (Mirabal 2009)
• Казаки 4,5 % (Underhill 2007)
• Пристень (Курск.) 4,4 % (Balanovsky 2008)
• Куб. казаки (Адыг.) 4,4 % (Balanovsky 2008)
• Казаки 4,1 % (Rootsi 2004)
• Русские Башкирии 4 % (Rootsi 2004)
• Липецкая обл. 4 % (Roewer 2008)
• Коми 3,6 % (Rootsi 2004)
• Порхов (Пск.) 3,5 % (Balanovsky 2008)
• Белгород 3,5 % (Balanovsky 2008)
• Белгородская обл. 3,5 % (Rootsi 2004)
• Репьевка (Воронеж.) 3,1 % (Balanovsky 2008)
• Воронеж 3,1 % (Underhill 2007)
• Новгородская обл. 3 % (Roewer 2008)
• Лезгины 3 % (Yunusbayev 2000)
• Кашин (Твер.) 2,7 % (Balanovsky 2008)
• Вепсы 2,6 % (Underhill 2007)
• Смоленская обл. 2 % (Roewer 2008)
• Орловская обл. 2 % (Roewer 2008)
• Рославль (Смол.) 1,9 % (Balanovsky 2008)
• Смоленск 1,9 % (Underhill 2007)
• Смоленская обл. 1,7 % (Rootsi 2004)
• Пинега (Арх.) 0,9 % (Balanovsky 2008)
• Пинега (Арх.) 0,8 % (Rootsi 2004)
• Татары 0,8 % (Rootsi 2004)
• Мезень (Арх.) 0 % (Balanovsky 2008)
• В работе Rootsi 2004 и Underhill 2007 выборка частично собрана из материала лаборатории Балановских.
• Известные люди
• Ярл Биргер (Биргер Ма́гнуссон) — правитель Швеции из рода Фолькунгов, ярл Швеции с 1248 года, зять короля Эрика Эрикссона, регент с 1250 до смерти. Основатель Стокгольма. У Биргера и его сына Эрика определена Y-гаплогруппа I1[15].
• Уоррен Баффетт — американский предприниматель, крупнейший в мире и один из наиболее известных инвесторов, состояние которого на сентябрь 2018 года оценивается в 108,4 млрд долларов. В исследованиях компании 23andMe, специализирующейся на ДНК тестах, упоминается, что Баффет генетически близок (по линии отличной от mtDNA) к людям, живущим в северной и центральной Европе, и его предки жили там с древних времён[16]. Это характеристика совпадает с историей и картой распространения Y-гаплогруппы I1. Крупные интернет-порталы, специализирующиеся на истории Европы и генетической генеалогии, интерпретируют эту информацию как наличии у Уоррена Баффетта Y-гаплогруппы I1[17].
• Джимми Баффетт — американский музыкант. Упоминается в том же исследовании компании 23andMe[16].
• Пётр Толстой — российский политик, журналист, продюсер и телеведущий. Заместитель председателя Государственной думы Федерального собрания Российской Федерации VII созыва с 5 октября 2016 года и руководитель российской делегации в Парламентской Ассамблее ОБСЕ с 2017 года. Праправнук графа Л. Н. Толстого. В рамках проекта «Моя родословная» его Y-гаплогруппа была определена как I1[18][17].
• Лев Николаевич Толстой — один из наиболее известных русских писателей и мыслителей, один из величайших писателей-романистов мира. Вероятнее всего имел Y-гаплогруппу I1, так как является предком Петра Толстого[18][17] по прямой мужской линии (см. выше).
• Стинг — британский музыкант-мультиинструменталист, певец и автор песен, актёр, общественный деятель и филантроп. Лидер группы The Police в 1976—1984 годах. С 1984 года выступает сольно. В восьмом эпизоде второго сезона шоу Finding Your Roots было показано, что он принадлежит к Y-гаплогруппе I1[19][17].
• Примечания
• YTree v5.02 at 11 February 2017
• Chiara Batini et al. Large-scale recent expansion of European patrilineages shown by population resequencing, 2015
• Origins, age, spread and ethnic association of European haplogroups and subclades (англ.). Eupedia, your guide to Europe in English (последнее обновление: март 2010). Дата обращения: 5 апреля 2010. Архивировано 4 марта 2012 года.
• Torsten Günther et al. Population genomics of Mesolithic Scandinavia: Investigating early postglacial migration routes and high-latitude adaptation, 2018
• Szécsényi-Nagy et al. (2015), Tracing the genetic origin of Europe’s first farmers reveals insights into their social organization, Proceedings of the Royal Society B, vol. 282, no. 1805, 20150339. (Previously published online 2014 elsewhere before print).
• Szécsényi-Nagy (2015), Molecular genetic investigation of the Neolithic population history in the western Carpathian Basin, PhD thesis Johannes Gutenberg-Universität in Mainz. Архивная копия от 21 июля 2015 на Wayback Machine
• Allentoft M. et al. (2015), Population genomics of Bronze Age Eurasia, Nature, 522, 167?172 (11 June 2015).
• Zenczak M. et al. (2017), Y-chromosome haplogroup assignment through next generation sequencing of enriched ancient DNA libraries
• Rui Martiniano et al. (19 января 2016), Genomic signals of migration and continuity in Britain before the Anglo-Saxons, Nature Communications volume 7, Article number: 10326 (2016)
• Carlos Eduardo G. Amorim et al. (11 сентября 2018), Understanding 6th-century barbarian social organization and migration through paleogenomics, Nature Communications volume 9, Article number: 3547 (2018)
• S. Sunna Ebenesersdóttir et al. (1 июня 2018), Ancient genomes from Iceland reveal the making of a human population, Science 01 Jun 2018: Vol. 360, Issue 6392, pp. 1028—1032
• ISOGG 2017 Y-DNA Haplogroup I. isogg.org. Дата обращения: 18 сентября 2017.
• Underhill et al, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory in Rethinking the Human Evolution, Mellars P, Boyle K, Bar-Yosef O, Stringer C, Eds. McDonald Institute for Archaeological Research, Cambridge, UK, pp. 33-42, 2007b.
• Трофимова Н. В. ИЗМЕНЧИВОСТЬ МИТОХОНДРИАЛЬНОЙ ДНК И Y-ХРОМОСОМЫ В ПОПУЛЯЦИЯХ ВОЛГО-УРАЛЬСКОГО РЕГИОНА, 2015
• Malmström H. et al. Finding the founder of Stockholm: a kinship study based on Y-chromosomal, autosomal and mitochondrial DNA, Annals of Anatomy — Anatomischer Anzeiger, online 5 April 2011 ahead of print.
• Are Warren and Jimmy Buffett Related?23andMe
• Famous people's Y-DNA listed by haplogroup (англ.). Eupedia, your guide to Europe in English.
• Петр Толстой. Моя родословная. Выпуск от 18.04.2010 Первый канал
• The British Invasion Finding Your Roots
• Ссылки
• ISOGG 2016 Y-DNA Haplogroup I

• Haplogrupp I1 I-M253(I-CTS6364)

Haplogrupp I1 är den haplogrupp som har störst genetiskt koncentration i området runt Skandinavien, och är i Sverige den vanligaste haplogruppen. Mutationerna som är identifierade som Haplogroup I1 (Y-DNA) är M253, M307, P30, och P40.[1]

• Haplogrupp I1 tros ha utvecklats ur haplogrupp I för ungefär 27.000 år sedan. Det troliga är att mutationen inträffat någonstans i Europa. Huvudsakligen tillhörde de förhistoriska jägar/samlare man kunnat undersöka haplogruppen I2, och det är därför oklart exakt var den uppstod. Bland bönder tillhöriga den Bandkeramiska kulturen i Ungern har flera fynd påträffats, och mycket tyder på att mutationen spridits till Norden med haplogruppen R1a-Z284 under tidig neolitikum och bronsålder. Det äldsta fyndet av en individ med haplogrupp I1 i Sverige härrör från 1.400 f. Kr. Fördelningen mellan haplogrupperna R1a, R1b och I1 är densamma hos samer som hos övriga skandinaver, vilket tyder på att dessa haplogrupper kommit in i den samiska genpolen relativt sent.[2]
• Se även
• Folkvandringstiden
• Germaner
• Y-kromosoms-Adam
• Referenser
• ^ Y-DNA Haplogroup I and its Subclades - 2013 (engelsk text)
• ^ [1]

Haplogroup I1 (M253) Wikipedia

• Possible time of origin 3,170–4,600[1]-5,070 BP (today's diversification)[2][3] (previously 11,000 BP[4] to 33,000 BP[5]%29 27,500 (diversification with I2-FGC77992)[1]
• Possible place of origin Northern Europe
• Ancestor I* (M170)
• Descendants I1a (DF29/S438);
• I1b (S249/Z131);
• I1c (Y18119/Z17925)
• Defining mutations M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187
• Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187.[6] It is a primary branch of Haplogroup I-M170 (I*).
• The haplogroup is believed to have been present among Upper Paleolithic European hunter-gatherers as a minor lineage but due to its near-total absence in pre-Neolithic DNA samples it can't have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a founder effect in the Nordic Bronze Age. Today it reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province).[7] In terms of national averages, I-M253 is found in 38-39% of Swedish males,[8][9][10] 37% of Norwegian males,[11][12][13] 34.8% of Danish males,[14][15][16]34.5% of Icelandic males,[17][18][19] and about 28% of Finnish males.[20] Bryan Sykes, in his 2006 book Blood of the Isles, gives the members – and the notional founding patriarch of I1 the name "Wodan".[21]
• Haplogroup I-M253 is a primary branch of haplogroup I* (I-M170), which has been present in Europe since ancient times. The other primary branch of I* is I-M438, also known as I2.
• All known living members descend from a common ancestor 6 times younger than the common ancestor with I2.[1]
• Before a reclassification in 2008,[22] the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).
• Contents
• 1 Origins
• 2 Structure
• 3 Historical expansion
• 4 Geographical distribution
• 5 Prominent members of I-M253
• 6 Markers
• 7 See also
• 8 References
• 9 Further reading
• 9.1 External links
• Origins
• Map of the early Nordic Bronze Age, where I1 first became prominent. The Nordic Bronze Age is often considered ancestral to the Germanic peoples.
• While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the Gravettian, so far DNA studies have only been able to locate it in one Mesolithic hunter-gatherer. As of April 2021, only 4 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:
• The first is a DNA sample from a Scandinavian hunter-gatherer with the label SF11 found on Stora Karlsö on Gotland. SF11 was found to have carried 9 of the 312 SNPs that define haplogroup I1. SF11 was classified as I1-Z2699*.[23][24][25][26] SF11 was not assigned to a specific archaeological culture due to the skeleton being found in the Stora Förvar cave on Stora Karlsö. The skeleton is dated to 5500 BC.
• The second is an individual sample labelled BAB5 from Neolithic Hungary.[27] BAB5 was found to have carried 1 of the 312 SNPs that define haplogroup I1. BAB5 may also be classified as I1-Z2699*.[28] BAB5 had a genetic affinity to other contemporary Neolithic farmers of Central Europe.
• Additionally, the third ancient I1 sample is from an individual found in a kurgan burial dating to the late Neolithic Dagger Period in Scandinavia labelled RISE179.[29] RISE179 had a genetic affinity to the populations of the Corded Ware culture and the Unetice culture.[30]
• The fourth ancient I1 sample predating the Nordic Bronze Age is labelled oll009 and was sequenced in the study titled "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon".[31] Oll009 is dated to the Scandinavian late Neolithic and was found in a burial in Sweden. Similar to RISE179, he carried a high percentage of Western Steppe-Herder ancestry and had a genetic affinity to the population of the Battle Axe culture and other populations of the Corded Ware horizon.[32]
• Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia.[33][34][35]Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying Western Steppe Herder ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age.[36][37][38]
• Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as Pitted Ware before becoming assimilated by the Battle Axe culture, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the Funnelbeaker culture in Central Europe. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.
• Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2570 BC.
• According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe.[2] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques.[3]
• In 2007, it was suggested that it initially dispersed from the area that is now Denmark.[14] However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower Elbe basin seems like the heartland of I1".
• Latest results (Sept. 2019) published by Y-Full suggest I1 (I-M253) was formed 27.500 ybp (95 CI: 29.800 ybp – 25.200 ybp) with TMRCA 4.600 ybp (95 CI: 5.200 ybp – 4.000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2570 BC, this likely puts the ancestor of all living I1 men somewhere in Central or Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion.[39][40] This suggests that I1 went from being a rare marker to a rather common one in a rapid burst.[41]
• Structure
• I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [6]
• I-DF29 (DF29/S438); I1a
• I-CTS6364 (CTS6364/Z2336); I1a1
• FGC20030; I1a1a~
• S4767; I1a1a1~
• I-M227; I1a1a1a1a
• A394; I1a1a2~
• Y11221; I1a1a3~
• A5338; I1a1a4~
• CTS10028; I1a1b
• I-L22 (L22/S142); I1a1b1
• CTS11651/Z2338; I1a1b1a~
• I-P109; I1a1b1a1
• I-Y3662; I1a1b1a1e~
• I-S14887; I1a1b1a1e2~
• I-Y11203; I1a1b1a1e2d~
• I-Y29630; I1a1b1a1e2d2~
• CTS6017; I1a1b1a2
• I-L205 (L205.1/L939.1/S239.1); I1a1b1a3
• CTS6868; I1a1b1a4
• I-Z74; I1a1b1a4a
• CTS2208; I1a1b1a4a1~
• I-L287; I1a1b1a4a1a
• I-L258 (L258/S335); I1a1b1a4a1a1
• I-L813; I1a1b1a4a2
• FGC12562; I1a1b1a4a3~
• CTS11603/S4744; I1a1b1b~
• I-L300 (L300/S241); I1a1b1b1a1
• FGC10477/Y13056; I1a1b2
• A8178, A8182, A8200, A8204; I1a1b3~
• F13534.2/Y17263.2; I1a1b4~
• I-Z58 (S244/Z58); I1a2
• I-Z59 (S246/Z59); I1a2a
• I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
• I-Z140 (Z140, Z141)
• I-L338
• I-F2642 (F2642)
• I-Z73
• I-L1302
• I-L573
• I-L803
• I-Z382; I1a2a2
• I-Z138 (S296/Z138, Z139); I1a2b
• I-Z2541
• I-Z63 (S243/Z63); I1a3
• I-BY151; I1a3a
• I-L849.2; I1a3a1
• I-BY351; I1a3a2
• I-CTS10345
• I-Y10994
• I-Y7075
• I-S2078
• I-S2077
• I-Y2245 (Y2245/PR683)
• I-L1237
• I-FGC9550
• I-S10360
• I-S15301
• I-Y7234
• I-BY62 (BY62); I1a3a3
• I-Z131 (Z131/S249); I1b
• I-CTS6397; I1b1
• I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c
• Historical expansion
• A timeline of the early Germanic expansions
• Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with Germanic peoples and are linked to the proto-Germanic speakers of the Nordic Bronze Age.[42][43] Current DNA research indicates that I1 was close to non-existent in most of Europe outside of Scandinavia and northern Germany before the Migration Period. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanics migrated across the Baltic Sea and settled alongside the Vistula. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the Goths.[44]
• I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. [45] The Kowalewko archeological site has been associated with the Wielbark culture. Therefore the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy.[46][47] The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.
• In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300-400 AD from Saxony-Anhalt in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe.[48]
• Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234.[49] Material findings associated with the Lombards have been excavated in Crypta Balbi.
• The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the Visigoths. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1.[50] This finding is in accordance with the common ancestral origin of the Visigoths and the Ostrogoths.
• The Anglo-Saxon settlement of Britain introduced I1 in the British Isles.[51]
• During the Viking Age, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia.[52]
• Geographical distribution
• I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking Age, or modern times. It is found in all places invaded by the Norse.
• During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia, New Zealand and Canada.
• Population Sample size I (total) I1 (I-M253) I1a1a (I-M227) Source
• Albanians (Tirana) 55 21.82%=(12/55) 3.6%=(2/55) 0.0 Battaglia et al. 2008
• Albanians (North Macedonia) 64 17.2%=(11/64) 4.7%=(3/64) 0.0 Battaglia et al. 2008
• Albanians (Tirana)
• Albanians (North Macedonia) 55+64=119 19.33%=(23/119) 4.2%=(5/119) 0.0 Battaglia et al. 2008
• Kosovo Albanians (Pristina) 114 7.96%=(9/114) 5.31%=(6/114) 0.0 Pericic et al. 2005
• Albanians (Tirana)
• Albanians (North Macedonia)
• Kosovo Albanians (Pristina) 55+64+114=233 13.73%=(32/233) 4.72%=(11/233) 0.0 Pericic et al. 2005
• Battaglia et al. 2008
• Austria 43 9.3 2.3 0.0 Underhill et al. 2007
• Belarus: Vitbsk 100 15 1.0 0.0 Underhill et al. 2007
• Belarus: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
• Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
• Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
• Czech Republic 47 31.9 8.5 0.0 Underhill et al. 2007
• Czech Republic 53 17.0 1.9 0.0 Rootsi et al. 2004
• Denmark 122 39.3% (48/122) 32.8% (40/122) 0.0 Underhill et al. 2007
• England 104 19.2 15.4 0.0 Underhill et al. 2007
• Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
• Estonia 118 11.9 Lappalainen et al. 2008
• Finland (national) 28.0 Lappalainen et al. 2006
• Finland: West 230 40% (92/230) Lappalainen et al. 2008
• Finland: East 306 19% (58/306) Lappalainen et al. 2008
• Finland: Satakunta region 50+ Lappalainen et al. 20089
• France 58 17.2 8.6 1.7 Underhill et al. 2007
• France 12 16.7 16.7 0.0 Cann et al. 2002
• France (Low Normandy) 42 21.4 11.9 0.0 Rootsi et al. 2004
• Germany 125 24 15.2 0.0 Underhill et al. 2007
• Greece 171 15.8 2.3 0.0 Underhill et al. 2007
• Hungary 113 25.7 13.3 0.0 Rootsi et al. 2004
• Ireland 100 11 6.0 0.0 Underhill et al. 2007
• Kazan Tatars 53 13.2 11.3 0.0 Trofimova 2015
• Latvia 113 3.5 Lappalainen et al. 2008
• Lithuania 164 4.9 Lappalainen et al. 2008
• Netherlands 93 20.4 14 0.0 Underhill et al. 2007
• Norway 1766 37% (653/1766) Stenersen et al 2006
• Russia (national) 16 25 12.5 0.0 Cann et al. 2002
• Russia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
• Russia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
• Russia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
• Russia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
• Russia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
• Russia: Cossacks 89 24.7 4.5 0.0 Underhill et al. 2007
• Russia: Karelians 140 10 8.6 0.0 Underhill et al. 2007
• Russia: Karelians 132 15.2 Lappalainen et al. 2008
• Russia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
• Slovakia 70 14.3 4.3 0.0 Rootsi et al. 2004
• Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
• Sweden (national) 160 35.6% (57/160) Lappalainen et al. 2008
• Sweden (national) 38.0 Lappalainen et al. 2009
• Sweden: Västra Götaland 52 Lappalainen et al. 2009
• Switzerland 144 7.6 5.6 0.0 Rootsi et al. 2004
• Turkey 523 5.4 1.1 0.0 Underhill et al. 2007
• Ukraine: Lviv 101 23.8 4.9 0.0 Underhill et al. 2007
• Ukraine: Ivanovo-Frankiv 56 21.4 1.8 0.0 Underhill et al. 2007
• Ukraine: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
• Ukraine: Cherkasy 114 28.1 4.3 0.0 Underhill et al. 2007
• Ukraine: Bilhorod 56 26.8 5.3 0.0 Underhill et al. 2007
• Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I1 to Anglo-Saxon mass migration into England, but not into Wales.
• In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[53] The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was
• that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.
• Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I-M253 is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)
• In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[54] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.
• Prominent members of I-M253
• Main article: List of haplogroups of historical and famous figures
• Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.[55]
• The Varangian Šimon, who was said to have been the founder of the Russian Vorontsov noble family, belonged to haplogroup I1-Y15024.[56][57] Testing by geneticist Peter Sjölund and FamilyTreeDNA showed that the present-day male members of the Vorontsov family still carry this subclade of I1, and downstream subclades.[58][59] Some prominent historical members of the Vorontsov family were Prince Mikhail Semyonovich Vorontsov, a Russian prince and field-marshal, as well as Count Illarion Ivanovich Vorontsov-Dashkov, a general of the Russian Empire.
• The Rurikid Prince Sviatopolk the Accursed (son of Vladimir the Great) was found to likely have carried the I1-S2077 subclade of I1-Z63.[60][61][62]
• Birger Jarl, 'Duke of Sweden' of the East Geatish House of Bjälbo, founder of Stockholm; his remains were exhumed and tested in 2002 and found to be I-M253.[63] The House of Bjälbo also provided three kings of Norway, and one king of Denmark in the 14th century.
• Sting was revealed to belong to haplogroup I1 by the PBS TV series Finding Your Roots.[64]
• William Bradford (governor) of the Mayflower, proven through the Mayflower DNA Project[65]
• William Brewster (Mayflower passenger) of the Mayflower, proven through the Mayflower DNA Project[65]
• General Robert E. Lee belonged to I-M253 based on DNA testing of his descendants as a part of the Lee DNA Project. Other prominent members of the Lee family of Virginia and Maryland were Richard Lee I and Richard Henry Lee. The latter was one of the Founding Fathers of the United States of America.[66]
• Robert I of Scotland, commonly known as Robert the Bruce, belonged to haplogroup I1. Descendant testing of Robert, 6th lord of Annandale de Brus, assigned the men of Clan Bruce to I1-Y17395.[67]
• The male members of the House of Grimaldi were revealed to carry haplogroup I1 as a part of the Grimaldi Genealogy DNA project.[68] They were lords and princes of Monaco up until 1949. The men of House Grimaldi belong to a Scandinavian subclade of I1, downstream of I1-Y3549.
• President Andrew Jackson belonged to haplogroup I1, based on results from the Jackson DNA project and from genealogy.[69][70]
• The Russian writer Leo Tolstoy was found to have carried I1. The testing of his male descendant Pyotr Tolstoy revealed that the males of the Tolstoy family carry I1-M253.[71][72]
• Snorri Sturluson was found to likely have belonged to haplogroup I1. Y-DNA testing of his presumed descendants revealed an assignment to I-M253. Their results are available on YSearch.org.[71]
• The Swedish scientist and theologian Emanuel Swedenborg and other male members of the Swedenborg noble family were found to belong to haplogroup I1-BY229, as a part of the I1-L1302 DNA project by Jakob Norstedt.[73][74]
• Siener van Rensburg, Boer patriotic figure and mystic, belonged to haplogroup I1.[75][76]
• Björn Wahlroos, Finnish businessman and millionaire, was found to belong to haplogroup I1.[71]
• The Finnish mathematician Rolf Nevanlinna belonged to I1-M253 based on the testing of his son Arne Nevanlinna by Geni.com.[77][78][79]
• Samuel Morse was found to have carried haplogroup I1 as a part of the Morse DNA project.[80][81][82]
• Footballers Sebastian Larsson and his father Svante Larsson were found to belong to I1-Y24470 through the testing of a family member.[83][84][85][86]
• Felix Kjellberg (PewDiePie) was found to belong to haplogroup I1-L22, according to testing by 23andMe.[87]
• Swedish actor Björn Andrésen belongs to haplogroup I1-L22 based on the ftDNA and 23andMe tests of one of his first cousins and one uncle on the paternal side as a part of their family research.[88][89][90][91]Their ancestor Johan Andrésen lived on both sides of the Swedish-Norwegian border.[92][93]
• As a part of the Pine family DNA project, actor Chris Pine was found to belong to haplogroup I1-A13819.[94][95]
• Markers
• DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).
• The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.
• Name: M253[96]
• Type: SNP
• Source: M (Peter Underhill of Stanford University)
• Position: ChrY:13532101..13532101 (+ strand)
• Position (base pair): 283
• Total size (base pairs): 400
• Length: 1
• ISOGG HG: I1
• Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
• Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
• YCC HG: I1
• Nucleotide alleles change (mutation): C to T
• Name: M307[97]
• Type: SNP
• Source: M (Peter Underhill)
• Position: ChrY:21160339..21160339 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: TTATTGGCATTTCAGGAAGTG
• Primer R: GGGTGAGGCAGGAAAATAGC
• YCC HG: I1
• Nucleotide alleles change (mutation): G to A
• Name: P30[98]
• Type: SNP
• Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)
• Position: ChrY:13006761..13006761 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: GGTGGGCTGTTTGAAAAAGA
• Primer R: AGCCAAATACCAGTCGTCAC
• YCC HG: I1
• Nucleotide alleles change (mutation): G to A
• Region: ARSDP
• Name: P40[99]
• Type: SNP
• Source: PS (Michael Hammer and James F. Wilson)
• Position: ChrY:12994402..12994402 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: GGAGAAAAGGTGAGAAACC
• Primer R: GGACAAGGGGCAGATT
• YCC HG: I1
• Nucleotide alleles change (mutation): C to T
• Region: ARSDP
• See also
• European ethnic groups
• Genetic history of Europe
• Germanic peoples
• History of Normandy
• Human Y-chromosome DNA haplogroups
• Late Glacial Maximum
• Neolithic Europe
• Norse colonization of the Americas
• Norse Sagas
• References
• https://yfull.com/tree/I1/
• Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
• Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6: 7152. doi:10.1038/ncomms8152. PMC 4441248. PMID 25988751.
• Rootsi S, Magri C, Kivisild T, Benuzzi G, Help H, Bermisheva M, et al. (July 2004). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe" (PDF). American Journal of Human Genetics. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323. Archived from the original (PDF) on 2009-06-24. Retrieved 2008-03-20.
• P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.
• ISOGG, Y-DNA Haplogroup I and its Subclades – 2017 (31 January 2017).
• Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
• Lappalainen T, Hannelius U, Salmela E, von Döbeln U, Lindgren CM, Huoponen K, et al. (January 2009). "Population structure in contemporary Sweden--a Y-chromosomal and mitochondrial DNA analysis". Annals of Human Genetics. 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID 19040656. S2CID 205598345.
• https://www.familytreedna.com/public/Sweden?iframe=ymap
• Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
• Dupuy BM, Stenersen M, Lu TT, Olaisen B (December 2006). "Geographical heterogeneity of Y-chromosomal lineages in Norway". Forensic Science International. 164 (1): 10–9. doi:10.1016/j.forsciint.2005.11.009. PMID 16337760.
• "FamilyTreeDNA - The Norway DNA Project - Norgesprosjektet". www.familytreedna.com. Retrieved 2020-11-26.
• "Y-DNA Haplogrupper". Norway DNA Norgesprosjektet. Retrieved 2020-12-27.
• Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
• Sanchez JJ (2004). "Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis" (PDF). International Congress Series. 1261: 347–349. doi:10.1016/S0531-5131(03)01635-2 – via isfg.org.
• "FamilyTreeDNA - Denmark DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland". The American Journal of Human Genetics. 67 (3): 697–717. 2000-09-01. doi:10.1086/303046. ISSN 0002-9297.
• "The Greater Nordic Regional Y-DNA Project". familytreedna. April 2021.
• Ebenesersdóttir, S. Sunna; Sandoval-Velasco, Marcela; Gunnarsdóttir, Ellen D.; Jagadeesan, Anuradha; Guðmundsdóttir, Valdís B.; Thordardóttir, Elísabet L.; Einarsdóttir, Margrét S.; Moore, Kristjan H. S.; Sigurðsson, Ásgeir; Magnúsdóttir, Droplaug N.; Jónsson, Hákon (2018-06-01). "Ancient genomes from Iceland reveal the making of a human population". Science (New York, N.Y.). 360 (6392): 1028–1032. doi:10.1126/science.aar2625. ISSN 1095-9203. PMID 29853688.
• Lappalainen T., Koivumäki S., Salmela E., Huoponen K., Sistonen P., Savontaus M.L., Lahermo P.; 2006, "Regional differences among the Finns: a Y-chromosomal perspective", Gene vol. 376, no. 2, pp. 207–15.
• "Blood of the Isles: exploring the genetic roots of our tribal history". History Ireland. 2013-02-22. Retrieved 2020-12-10.
• Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (May 2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
• Gunther T (2017). "Genomics of Mesolithic Scandinavia reveal colonization routes and high-latitude adaptation" (PDF). Nature. 23: 6 – via Biorxiv.
• SF11 - Stora Förvar, Stora Karlsö I-Z2699*. "Haplotree.info sample: SF11". haplotree.info.
• Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014). "Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers". Science. 344 (6185): 747–50. Bibcode:2014Sci...344..747S. doi:10.1126/science.1253448. PMID 24762536. S2CID 206556994.
• "familytreedna.com I-Z2699 tree". familytreedna. April 2021.
• Szécsényi-Nagy A, Brandt G, Haak W, Keerl V, Jakucs J, Möller-Rieker S, et al. (April 2015). "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". Proceedings. Biological Sciences. 282 (1805). doi:10.1098/rspb.2015.0339. PMC 4389623. PMID 25808890.
• 5&ybp=500000,0 "BAB5 I-Z2699*" Check |url= value (help). haplotree.info.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• "YFull | The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". www.yfull.com. Retrieved 2021-01-24.
• Malmstrom H (July 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" (PDF). Uppsala Genomics. 1: 3 – via jakobssonlab.iob.uu.se/.
• Sánchez-Quinto F, Malmström H, Fraser M, Girdland-Flink L, Svensson EM, Simões LG, et al. (May 2019). "Megalithic tombs in western and northern Neolithic Europe were linked to a kindred society". Proceedings of the National Academy of Sciences of the United States of America. 116 (19): 9469–9474. doi:10.1073/pnas.1818037116. PMC 6511028. PMID 30988179.
• Malmström H, Linderholm A, Skoglund P, Storå J, Sjödin P, Gilbert MT, et al. (January 2015). "Ancient mitochondrial DNA from the northern fringe of the Neolithic farming expansion in Europe sheds light on the dispersion process". Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 370 (1660): 20130373. doi:10.1098/rstb.2013.0373. PMC 4275881. PMID 25487325.
• Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014). "Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers". Science. 344 (6185): 747–50. Bibcode:2014Sci...344..747S. doi:10.1126/science.1253448. PMID 24762536. S2CID 206556994.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• Karlsson AO, Wallerström T, Götherström A, Holmlund G (August 2006). "Y-chromosome diversity in Sweden - a long-time perspective". European Journal of Human Genetics. 14 (8): 963–70. doi:10.1038/sj.ejhg.5201651. PMID 16724001. S2CID 23227271.
• Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
• Poznik GD, Xue Y, Mendez FL, Willems TF, Massaia A, Wilson Sayres MA, et al. (June 2016). "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics. 48 (6): 593–9. doi:10.1038/ng.3559. hdl:11858/00-001M-0000-002A-F024-C. PMC 4884158. PMID 27111036.
• Woodley M (February 2017). "Holocene selection for variants associated with cognitive ability: Comparing ancient and modern genomes" (PDF). www.biorxiv.org/. doi:10.1101/109678. S2CID 196631764. Retrieved 27 January 2021.
• Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6: 7152. Bibcode:2015NatCo...6.7152B. doi:10.1038/ncomms8152. PMC 4441248. PMID 25988751.
• Schmidt KH (1991). "The Celts and the Ethnogenesis of the Germanic People". Historische Sprachforschung / Historical Linguistics. 104 (1): 129–152. ISSN 0935-3518. JSTOR 40849016.
• Bergerbrant S (May 2007). "Bronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BC" (PDF). Stockholm Studies in Archaeology. 43: 7–201 – via diva-portal.org.
• Teska M, Michalowski A (2014). "Connection between Wielkopolska and the Baltic Sea Region in the Roman Iron Age". www.semanticscholar.org. S2CID 56295624. Retrieved 2020-12-10.
• Zenczak M, Handschuh L, Juras A, Marcinkowska-Swojak M, Philips A, Piontek J, Stolarek I, Figlerowicz M (2017). Y-Chromosome Haplogroup Assignment Through Next Generation Sequencing of Enriched Ancient DNA Libraries. Anthropological Genetics. p. Presentation number: AG 16.
• Amorim CE, Vai S, Posth C, Modi A, Koncz I, Hakenbeck S, et al. (September 2018). "Understanding 6th-century barbarian social organization and migration through paleogenomics". Nature Communications. 9 (1): 3547. Bibcode:2018NatCo...9.3547A. doi:10.1038/s41467-018-06024-4. PMC 6134036. PMID 30206220.
• Estes R (2020-10-16). "Longobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?". DNAeXplained - Genetic Genealogy. Retrieved 2020-12-11.
• Labudde D (July 2015). "Gender distribution of excavation finds from the Roman imperial and migration period". ResearchGate. 1: 2 – via ResearchGate.net.
• Antonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, et al. (November 2019). "Ancient Rome: A genetic crossroads of Europe and the Mediterranean". Science. 366 (6466): 708–714. Bibcode:2019Sci...366..708A. doi:10.1126/science.aay6826. PMC 7093155. PMID 31699931.
• Olalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, et al. (March 2019). "The genomic history of the Iberian Peninsula over the past 8000 years". Science. 363 (6432): 1230–1234. Bibcode:2019Sci...363.1230O. doi:10.1126/science.aav4040. PMC 6436108. PMID 30872528.
• Martiniano R, Caffell A, Holst M, Hunter-Mann K, Montgomery J, Müldner G, et al. (January 2016). "Genomic signals of migration and continuity in Britain before the Anglo-Saxons". Nature Communications. 7 (1): 10326. Bibcode:2016NatCo...710326M. doi:10.1038/ncomms10326. PMC 4735653. PMID 26783717.
• Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–396. doi:10.1101/703405. PMID 32939067. S2CID 201195157.
• Weale ME, Weiss DA, Jager RF, Bradman N, Thomas MG (July 2002). "Y chromosome evidence for Anglo-Saxon mass migration". Molecular Biology and Evolution. 19 (7): 1008–21. doi:10.1093/oxfordjournals.molbev.a004160. PMID 12082121.
• Capelli C, Redhead N, Abernethy JK, Gratrix F, Wilson JF, Moen T, et al. (May 2003). "A Y chromosome census of the British Isles". Current Biology. 13 (11): 979–84. doi:10.1016/S0960-9822(03)00373-7. PMID 12781138. S2CID 526263.
• "Founding Father DNA". isogg.org.
• "FamilyTreeDNA - Genetic Testing for Ancestry, Family History & Genealogy". www.familytreedna.com. Retrieved 2020-12-10.
• "Faderslinjen, DNA". www.sikaby.se. Retrieved 2020-12-10.
• "FamilyTreeDNA - RussiaDNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Vår vikingahövding i österled". www.sikaby.se. Retrieved 2020-12-10.
• "Sample from Homo sapiens - BioSample - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-10.
• Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–396. Bibcode:2020Natur.585..390M. doi:10.1038/s41586-020-2688-8. PMID 32939067.
• Duczko W (2004-01-01). Viking Rus: Studies on the Presence of Scandinavians in Eastern Europe. BRILL. ISBN 978-90-04-13874-2.
• Malmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MT, et al. (January 2012). "Finding the founder of Stockholm - a kinship study based on Y-chromosomal, autosomal and mitochondrial DNA". Annals of Anatomy = Anatomischer Anzeiger. Special Issue: Ancient DNA. 194 (1): 138–45. doi:10.1016/j.aanat.2011.03.014. PMID 21596538.
• The British Invasion Finding Your Roots
• "Mayflower DNA Project". mayflowerdna.org. Retrieved 2020-11-23.
• "FamilyTreeDNA - Lee Surname DNA Research Project (and Leigh, Lea, etc)". www.familytreedna.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - I1-S4795". www.familytreedna.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - GRIMALDI GENEALOGY PROJECT at FtDNA". www.familytreedna.com. Retrieved 2020-12-11.
• "Jackson DNA Project". FamilyTreeDNA. 11 December 2020.
• Hay M (July 2020). "Origins and history of Haplogroup I1 (Y-DNA)". ResearchGate. 1: 9.
• Maciamo E. "Haplogroup I1 (Y-DNA)". Eupedia. Retrieved 2020-12-11.
• Петр Толстой. Моя родословная. Выпуск от 18.04.2010 (in Russian), retrieved 2020-12-15
• "I-BY229 YTree". yfull.com. Retrieved 2020-12-10.
• "Swedenborg". Höijen (in Swedish). Retrieved 2020-12-10.
• "Claas Jansz van Rensburg, SV/PROG". geni_family_tree. Retrieved 2021-01-03.
• "janse /jansen van Rensburg I-M253 genealogy discussion". geni_family_tree. Retrieved 2021-01-03.
• "Rolf H. Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
• olenus (2018-03-30). "I1: Rolf Nevanlinna (né Neovius)". Descendants of haplogroup IJ-M429. Retrieved 2020-12-26.
• "Arne Edvard Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
• "Morse/Moss DNA Testing". morsesociety.org. Retrieved 2020-12-10.
• "FamilyTreeDNA - Morse / Moss DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Peter Morse's Family Tree". www.geni.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - Sweden DNA PROJECT - Sverigeprojektet". www.familytreedna.com. Retrieved 2021-02-14.
• "Eskilstuna kommun · EM GN398 - Familjen Larsson, Torshälla ca 1900". Eskilstuna kommun (in Swedish). Retrieved 2021-02-14.
• "I-Y24470 YTree". www.yfull.com. Retrieved 2021-02-14.
• "Familjen Larssons Anfäder". hosserudkullen.se. Retrieved 2021-02-14.
• https://www.youtube.com/watch?v=sLJ9my42vR4
• "FamilyTreeDNA - The Norway DNA Project - Norgesprosjektet". www.familytreedna.com. Retrieved 2021-02-02.
• Tovseth A (June 2018). "Andrésen, Färnskog & Hansen family research". Kjellivar.tripod.com. Retrieved 2 February 2021.
• "Personer med namnet Andresen | Släktingar.se". www.slaktingar.se. Retrieved 2021-02-02.
• "BJÖRN ANDRESEN: Min passion för mamma blev aldrig besvarad - Katarina Hahr möter". Radio Sveriges (in Swedish). Retrieved 2021-02-02.
• "Johan Peter Andresen - Ancestry". www.ancestry.se. Retrieved 2021-02-02.
• "Family tree of Daniel ANDRESEN". Geneanet. Retrieved 2021-02-02.
• "FamilyTreeDNA - Pine/Pyne Genealogy DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "James Pine, Sr". geni_family_tree. Retrieved 2020-12-10.
• snpdev. "Reference SNP (refSNP) Cluster Report: rs9341296". nih.gov.
• snpdev. "Reference SNP (refSNP) Cluster Report: rs13447354". nih.gov.
• P30[permanent dead link]
• P40[permanent dead link]
• Further reading
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. doi:10.1038/nature14507. PMID 26062507.
• Brunel S, Bennett EA, Cardin L, Garraud D, Barrand Emam H, Beylier A, et al. (June 2020). "Ancient genomes from present-day France unveil 7,000 years of its demographic history". Proceedings of the National Academy of Sciences of the United States of America. 117 (23): 12791–12798. doi:10.1073/pnas.1918034117. PMC 7293694. PMID 32457149.</ref>
• Malmström H, Gilbert MT, Thomas MG, Brandström M, Storå J, Molnar P, et al. (November 2009). "Ancient DNA reveals lack of continuity between neolithic hunter-gatherers and contemporary Scandinavians". Current Biology. 19 (20): 1758–62. doi:10.1016/j.cub.2009.09.017.
• Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, Pospieszny Ł, Tõrv M, Lindström J, Götherström A, Storå J, Jakobsson M (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
• Villalba-Mouco V, van de Loosdrecht MS, Posth C, Mora R, Martínez-Moreno J, Rojo-Guerra M, et al. (April 2019). "Survival of Late Pleistocene Hunter-Gatherer Ancestry in the Iberian Peninsula". Current Biology. Cell Press. 29 (7): 1169–1177.e7. doi:10.1016/j.cub.2019.02.006. PMID 30880015. S2CID 76663708.
• External links
• Haplogroup I databases
• Haplogroup I1 Project at FTDNA
• Danish Demes Regional DNA Project at FTDNA
• Haplogroup I-P109 Project
• British Isles DNA Project
• General Y-DNA databases
• There are several public access databases featuring I-M253, including:
• http://www.ysearch.org/
• http://www.yhrd.org/
• http://www.yfull.com/

tree/I1/

Haplogroup I-M253(I-CTS6364)

Haplogroup I1 (M253) Wikipedia

• Гаплогрупа I1, або за загальною номенклатурою I-M253 є гаплогрупою людської ДНК Y-хромосоми, разом з гаплогрупою I2 є головною галуззю гаплогрупи I-M170 (гаплогрупа І).
• Сформована 27500 років тому з загальним предком 4700 років тому.[1]
• Найбільшої частоти у 52 % гаплогрупа І1 сягає у західному шведському лені Вестра-Йоталанд, а також понад 50 % — у південно-західній фінській провінції Сатакунта. Середня частота поширення гаплогрупи I-M253 є 35–38 % серед шведів, 32,8 % серед данців, 31,5 % серед норвежців та 28 % серед фінів. Серед чоловіків-українців гаплогрупа I1 за поширеністю є на 6-му місці й складає 3,7 % (22/601).
• Прозивається гаплогрупою «давньо-північно-європейською», або «вікінговою».
• Зміст
• 1 Походження та історія
• 2 Зовнішня структура
• 3 Внутрішнє дерево
• 4 I-Z2336 (I1a1)
• 4.1 I-S4767 (I1a1a1)
• 4.2 I-L22 (I1a1b1)
• 5 I-Z58 (I1a2)
• 6 I-CTS8647 (I1a2a1)
• 7 I-Z63 (I1a3)
• 7.1 I-S2078 (I1a3a)
• 8 I1 серед українців
• 9 Відомі носії
• 10 Джерела
• 11 Примітки
• Походження та історія
• Гаплогрупа I є найстародавнішою основною європейською гаплогрупою що з'явилася саме у Європі, за винятком невеликих гаплогруп, як, наприклад, гаплогрупа C1a2, які також сформувалися у Європі. Гаплогрупа IJ поширилася з Передньої Азії на Балкани 35000 років тому. Згодом сформувалася гаплогрупа I незадовго після того. ДНК дослідження стародавніх носіїв оріньякської культури (45000-28000 років тому) вказують на те, що перші колонізатори Європи належали гаплогрупам CT, C1a, C1b, F and I. Гілка I1 виділилася у гаплогрупі I приблизно 27500 років тому. Вона відрізняється від материнської гаплогрупи І приблизно 300 унікальними мутаціями вказує що початкова група пройшла через серйозний ефект людської «пляшкової шийки» у своєму розвитку.
• Більшість зразків останнього зледеніння та середньокам'яної доби належать до гаплогруп I* або I2. Досі незрозуміло у якій частині Європи виникла гаплогрупа I1. Теорія про скандинавське виникнення гаплогрупи I1, коли люди поверталися на північ після останнього зледеніння, протирічать дані досліджені Лазаврідісом у 2013 році носіїв середньокам'яної аренгсбурзької культури (10000-8000 років до Р. Х.) у Швеції що виявилися виключно представниками гаплогрупи I2.
• Найдавніший зразок гаплогрупи I1 відноситься до ранньої новокам'яної доби з заходу Угорщини (Szécsényi-Nagy et al. (2014)). Цей зразок був знайдений разом зі зразком близькосхідних хліборобів G2a2b, що відносилися до ранньої культури лінійно-стрічкової кераміки. Лінійно-стрічкової кераміки культура поширила новий сільськогосподарський спосіб життя на Польщу, Німеччину, Нідерланди та Бельгію. За нею послідувала культура лійчастого посуду (4300-2800 роки до Р. Х.) з ареалом поширення на півночі Центральної Європи та на півдні Скандинавії. Разом з цими культури поширювалася й гаплогрупа І1.
• Можливо мисливці та збирачі гаплогрупи І1 були асимільовані близькосхідними хліборобами G2a, чому свідчать співіснування I2a та G2a за старчевської (5500-4500 роки до Р. Х.) та кардіальної кераміки (6400-5500 роки до Р. Х.) культур. Гаплогрупа І1 була майже рівномірно поширена серед неолітичних хліборобів культури лінійно-стрічкової кераміки (5500-4500 років до Р. Х.). Саме природні здібності до мисливства та збиральництва на додачу до нових хліборобських традицій допомогли гаплогрупі І1 розплодитися на півночі Центральної Європи. Згодом гаплогрупа І1 поширилася з північної Німеччини у Скандинавію, де знаходиться її сучасний центр популяції. Проте проникнення у Скандинавії не було тотальним. Так зразок культури ямної кераміки (3200-2300 роки до Р. Х.) зі Швеції виявися належним гаплогрупі I2a1 але не I1.
• Скоглунд у 2012 році порівняв ДНК одного хлібороба та трьох мисливців-збирачів зі Швеції доби культури лійчастого посуду (3000 років до Р. Х.), коли протягом кількох сторіч мисливці та хлібороби жили поруч. Хлібороб виявився генетично близьким до сучасних середземноморців, а особливо до сардинців. Мисливці-збирачі генетично більш нагадують сучасних балтів, фінів та саамів ніж сучасних скандинавів.
• Холодний клімат не дозволяв справжнім хліборобам заселити Скандинавію. Тому населення сучасної Скандинавії, саами, фіни, балти та північні росіяни залишили переважно середньокам'яне походження. З хліборобського способу життя на додачу рибальства, мисливства та збирання у Скандинавії додалися утримання домашніх тварин (вівці, корів, свиней та кіз).
• Населення культури лійчастого посуду, де розквітла гаплогрупа І1 було успішно асимільоване наступною культурою шнурової кераміки (культурою бойових сокир у Скандинавії). Саме більшість сучасних носіїв гаплогрупи І1 мають загального предка, що припадає на перехід між культурами лійчастого посуду та шнурової кераміки.
• Зовнішня структура
• Гаплогрупа I1, разом з гаплогрупою I2 є частиною гаплогрупи I (M170), так званої «стародавньої європейської». Її попередницею є гаплогрупа IJ (M429) у межах якої вона споріднена з «семітською» гаплогрупою J. Гаплогрупа IJ є частиною гаплогрупи IJK (M522|M523) у межах якої вона Гаплогрупа I2 споріднена з усім поза-африканським чоловічим населенням.
• IJK (M522|M523)
• IJ (M429/P125)
• I (M170)
• I1 (M253)
• I2 (M438)
• J (M304)
• K (M9)
• Внутрішнє дерево
• I1 (M253)
• DF29 (I1a) — належать 99 % носіїв гаплогрупи I1
• Z2336 (I1a1)
• Z58 (I1a2)
• Z63 (I1a3)
• A5697 (I1a4)
• FGC15556 (I1a5)
• Y11205 (I1a6)
• Y14628 (I1a7)
• Y11252 (I1a9)
• Y18697 (I1a10)
• Z17954 (1I1b)
• Z131 (I1b) — малочисельна підгалузь зустрічається на колишньому кельтсько-німецькому порубіжжі у Чехії, центральній Німеччині, Бельгії, а також У Швеції та Британії
• Z17943 (I1c) — малочисельна підгалузь зустрічається у Німеччині, Франції та Англії
• Y21293 (I1e)
• Y19092 (I1f)
• I-Z2336 (I1a1)
• Z2336 (I1a1) сформувався 4600 років тому. Загальний предок жив 4200 років тому.
• Також відносяться 3 снипи.
• Z2336 або CTS6364 є головною «нордичною», або «вікінговою» галуззю гаплогрупи І1 з центром переважно у Скандинавії, Німеччині та у польському Помор'ї.
• Найближче розгалуження дерева I-Z2336:
• Z2336 — переважно у Скандинавії
• Y3866
• A394 — у Німеччині
• Y11221 — переважно у Швеції, також виявлено у Норвегії та Угорщині (тут найдавніший — 3000 років тому)
• A5338 — переважно у Норвегії, але також зустрічається у Швеції, Англії, Фінляндії та Шотландії (підгалузь Y17395 сформована 1150 років тому).
• S4767 — сформований 3900 років тому; здебільшого у Швеції та Норвегії, потім у Данії, Польщі та Литві.
• Z2337
• A8182 — виявлено у Швеції, Німеччині та Англії
• Y16813 — виявлено у Швеції а також у Фінляндії
• Y13056 — виявлено у Норвегії, Англії, Швеції та Німеччині
• L22 — дуже велика «нордична» або «дансько-вікінгова» галузь, що є звичайною у Британії, а особливо на східному узбережжі де оселялися вікінги, у Голландії, Фландрії, Нормандії, Польщі та у новгородсько-псковському куті Росії. Гаплогрупа L22>Y3549>P109>Y3662>S14887>Y11203>FGC22046>FGC22045>FGC22045 є першою за частотою серед підгалузей Ы1 у Сербії (друга за частотою є M253>DF29>Z63>S2078>S2077>Y16435).
• I-S4767 (I1a1a1)
• S4767 (I1a1a1) сформувався 3900 років тому. Загальний предок жив 3900 років тому.
• Гаплогрупа присутня в Україні.
• Найближче розгалуження дерева I-S4767:
• S4767 — найдавніші зразки зі Швеції
• Y4781
• S4770 — переважно у Данії, Норвегії та Фінляндії. Також виявлені у Швеції, Литві, Білорусі, Англія та Палестині.
• S7642
• Y6339 — переважно у Швеції. Також виявлені у Норвегії та Фінляндії.
• Y6340 — переважно у Польщі. Також виявлені в Україні, Німеччині та Швеції.
• S11236 — переважно у Швеції. Також виявлені у Норвегії.
• Y17933 — виявлені у Польщі та Литві
• Y21671 — виявлені у Швеції та Англії
• I-L22 (I1a1b1)
• L22 (I1a1b1) сформувався 4100 років тому. Загальний предок жив 4100 років тому.
• Також S142.
• Гаплогрупа L22 присутня в Україні. Поширенням гаплогрупи простежуються поширення середньовічних вікінгів.
• Найближче розгалуження дерева I-L22:
• L22 — переважно у Скандинавії
• Y3549 — найстаріші зразки у Швеції
• P109 — так звана гаплогрупа «данських вікінгів». Переважно виявлена у Англії, Швеції, Норвегії та Ірландії. Також виявлені у Франції, Шотландії, Нідерландах, Данії, Німеччині, Польщі, Фінляндії, Росії, Хорватії, Сербії, Боснії, Чорногорії та Італії
• CTS6868 — найбільше представників наплогрупи виявлено у Фінляндії. Також велике представництво у виявлене Швеції, Норвегії та Англії. Також виявлені у Франції, Шотландії, Німеччині, Росії, Нідерландах та Ірландії.
• L205 — виявлена переважно у Англії. Також у Норвегії
• Y12991 — виявлена у Швеції, Норвегії та Англії
• Y3603
• S9318 — переважно у Швеції. Також виявлена у Англії та Болгарії
• Y10640 — виявлена у Швеції
• Y19413 — виявлена у Шотландії та Франції
• CTS11603
• Y5473 переважно у Англії та Швеції. Також виявлена у Фінляндії, Росії, Німеччині та Ірландії.
• Y14328 — виявлена у Швеції, Фінляндії, Нідерландах та Англії
• Y21091
• Y24789 — виявлена у Швеції та Англії
• PH5383 — виявлена у Швеції
• Y23687
• Y23693 — виявлена у Швеції та Німеччині
• I-Z58 (I1a2)
• Z58 (I1a2) сформувався 4600 років тому. Загальний предок жив 4600 років тому.
• Також відносяться S244.
• Z58 є головним чином західнонімецькою гаплогрупою з відчутною присутністю у Німеччині, Нідерландах, Бельгії та у Британії. З меншою частотою у Скандинавії та у континентальній Європі.
• Найближче розгалуження дерева I-Z58:
• Z58
• Z59 — головна галузь Z58
• CTS8647 — головна галузь Z59
• Z2041 — переважно у Швеції, Норвегії, Фінляндії та Англії. Виявлені також у Італії, Німеччині, Словенії, Болгарії, Данії та Росії.
• Z138 — з низькою частотою поширений у германомовних країнах, а також у Ірландії, Португалії, в Угорщині, Румунії та на півдні Італії.
• S2293 — переважно у Англії, Шотландії та Німеччині. Також виявлені на заході України, Румунії, Словаччині, Швеції, Норвегії, Данії, Ірландії, Швейцарії, Франції, Люксембурзі, Італії та Португалії
• S5619 — виявлена в Угорщині, Італії та Англії
• PH1610
• PH2364
• I-CTS8647 (I1a2a1)
• CTS8647 (I1a2a1) сформувався 4300 років тому. Загальний предок жив 4300 років тому.
• Найближче розгалуження дерева I-CTS8647:
• CTS8647
• Z60 — виявлена серед германського світу
• CTS7362
• CTS9352
• Z73 — присутня в Україні; належала до вікінгів; присутня переважно у Скандинавії, Фінляндії, на східному узбережжі Англії та на островах Шотландії; також у Росії
• L573
• L1248
• PF3158
• Z140 — присутня в Україні; західно-германська" гаплогрупа; переважно у центральній та південній Німеччині, Швейцарії, Нідерландах, північній Франції та Британії. Майже відсутня у Скандинавії. Також виявлена в Україні, Росії, Польщі, Чехії, Словенії, центральній та південній Італії та Іспанії.
• Z141
• Z2535
• S2169
• A196
• Y6231 — підгалузь Y10890 виявлена у центральній та південній Італії де оселилися ломбарди (Ortona, Alifae, Campobasso) та вандали (Trapani).
• A1605
• Y15150
• Y12342
• Y22033
• Y31031
• I-Z63 (I1a3)
• Z63 (I1a3) сформувався 4600 років тому. Загальний предок жив 4000 років тому.
• Також відносяться S243.
• Переважно «готська» гаплогрупа за поширенням є чисто континентально-германською, що майже відсутня у Скандинавії. Найчастіше зустрічається у Польщі, центральній Німеччині, Нідерландах, Бельгії, Англії, Нижній Шотландії. Також виявлено В Україні, Росії, на Балканах, в Італії, Іспанії та Португалії.
• Найближче розгалуження дерева I-Z63:
• Z63
• BY151
• S2078 — широко поширена галузь у більшій частині Європи, проте відносно рідкісна у Бенілюксі, Британії та у Скандинавії
• BY351 — поширена в Україні, Польщі, Хорватії Італії включно з Сардинією поширений візіготами та остготамим. Зв'язана з оксивською, черняхівською культурами, остготським та візіготським королівствами.
• Y8331
• Y15565
• Y19648
• Y13952
• I-S2078 (I1a3a)
• S2078 (I1a3a) сформувався 4000 років тому. Загальний предок жив 3900 років тому.
• Також відносяться Y11823/FGC9505.
• S2078 є підгалуззю I-Z63. Широко поширена у більшій частині Європи, проте відносно рідкісна у Бенілюксі, Британії та у Скандинавії.
• Найближче розгалуження дерева I-S2078:
• S2078
• S2077
• Y2245 — підгалузь складає великий шмат гаплогрупи Z63 в Україні, Росії, Польщі, на Балканах, в Італії та на Іберійському півострові. Також виявлено у Боснії, Албанії, Чехії, Німеччині, Франції, Англії та Лівані. Поширені готами.
• L1237 — виявлено в Україні, Росії, Польщі, Чехії, Сербії, Боснії, північній Італії, Франції та Швеції. Готське походження.
• Y6634
• Y6615
• BY3386/A8249 — головним чином поширений у Британії
• Y33064
• A11537
• Y3968 — виявлено в Україні, Росії, Польщі, Німеччині, Англії, Скандинавії, Фінляндії, Угорщині, Італії, Іспанії, Португалії. Належав частково готам та іншим етнічним групам.
• Y7234 — виявлено у Польщі, Німеччині, Бельгії, Франції та Іспанії.
• Y6375 — виявлено у Британії
• S2097 — особливо виявлено в Італії (Ломбардія та Сицилія) та в Іспанії (Каталонія, Мадрид та Екстремадура). Ймовірно готського походження.
• Y16435 — виявлено у Сербії (друга за частотою гаплогрупа після M253>DF29>Z2336>Z2337>L22>Y3549>P109>Y3662>S14887>Y11203>FGC22046>FGC22045>FGC22045).
• Y24458
• I1 серед українців
• За даними трьох груп Familytree DNA[2][3][4], де сконцентровані українці, носіями I1 (M253) є 22 з 601, тобто 3,7 %.
• З 22 носіїв гаплогрупи I1 усі належать до гаплогрупи I-DF29 (I1a) проте тільки 19 мають достатьно глибоке дослідження ДНК для подальшого розгалуження дерева:
• I-Z2336 (I1a1) «вікінгова» гаплогрупа виявлена у 3-х чоловіків-українців або у 15,8 % носіїв гаплогрупи І1,
• I-Z58 (I1a2) «фризько-саксонська» виявлена у 7 чоловіків-українців або у 36,8 %,
• I-Z63 (I1a3) «готська» гаплогрупа виявлена у 9 чоловіків-українців або у 47,4 %.
• Відомі носії
• Лев Толстой (1828—1910) — відомий російський письменник,
• Сергій Лук'яненко — відомий російський фантаст, українофоб,
• Олександр Гамільтон 1(1755 або 1757—1804) — батько-засновник ЗДА,
• Ендрю Джексон (1767—1845) — 7-й президент США у 1829—1837 роках,
• Джіммі Картер — 39-й американський президент,
• Білл Клінтон — 42-й американський президент,
• Воррен Баффет — американський магнат,
• Стінг (Гордон Самнер) — відомий англійський співак
• Толстой
• Лук'яненко
• Гамільтон
• Джексон
• Картер
• Баффет
• Клінтон
• Стинг (Самнер)
• Джерела
• Eupedia Genetics Haplogroup I1 (Y-DNA)
• FamilytreeDNA Ukrainian DNA Project
• YFull YTree I1
• ISOGG Haplogrop I
• Молекулярная генеалогия. Гаплогруппа I1
• Примітки
• https://www.yfull.com/tree/IJK/
• https://www.familytreedna.com/groups/ukrainian-dna/dna-results
• https://www.familytreedna.com/groups/ukraine/dna-results
• https://www.familytreedna.com/groups/russiadna/dna-results

Haplogroup I-M253(I-CTS6364)

Haplogroup I1 (M253) Wikipedia

• Possible time of origin 3,170–4,600[1]-5,070 BP (today's diversification)[2][3] (previously 11,000 BP[4] to 33,000 BP[5]%29 27,500 (diversification with I2-FGC77992)[1]
• Possible place of origin Northern Europe
• Ancestor I* (M170)
• Descendants I1a (DF29/S438);
• I1b (S249/Z131);
• I1c (Y18119/Z17925)
• Defining mutations M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187
• Haplogroup I-M253, also known as I1, is a Y chromosome haplogroup. The genetic markers confirmed as identifying I-M253 are the SNPs M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187.[6] It is a primary branch of Haplogroup I-M170 (I*).
• The haplogroup is believed to have been present among Upper Paleolithic European hunter-gatherers as a minor lineage but due to its near-total absence in pre-Neolithic DNA samples it can't have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a founder effect in the Nordic Bronze Age. Today it reaches its peak frequencies in Sweden (52 percent of males in Västra Götaland County) and western Finland (more than 50 percent in Satakunta province).[7] In terms of national averages, I-M253 is found in 38-39% of Swedish males,[8][9][10] 37% of Norwegian males,[11][12][13] 34.8% of Danish males,[14][15][16]34.5% of Icelandic males,[17][18][19] and about 28% of Finnish males.[20] Bryan Sykes, in his 2006 book Blood of the Isles, gives the members – and the notional founding patriarch of I1 the name "Wodan".[21]
• Haplogroup I-M253 is a primary branch of haplogroup I* (I-M170), which has been present in Europe since ancient times. The other primary branch of I* is I-M438, also known as I2.
• All known living members descend from a common ancestor 6 times younger than the common ancestor with I2.[1]
• Before a reclassification in 2008,[22] the group was known as I1a, a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).
• Contents
• 1 Origins
• 2 Structure
• 3 Historical expansion
• 4 Geographical distribution
• 5 Prominent members of I-M253
• 6 Markers
• 7 See also
• 8 References
• 9 Further reading
• 9.1 External links
• Origins
• Map of the early Nordic Bronze Age, where I1 first became prominent. The Nordic Bronze Age is often considered ancestral to the Germanic peoples.
• While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the Gravettian, so far DNA studies have only been able to locate it in one Mesolithic hunter-gatherer. As of April 2021, only 4 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:
• The first is a DNA sample from a Scandinavian hunter-gatherer with the label SF11 found on Stora Karlsö on Gotland. SF11 was found to have carried 9 of the 312 SNPs that define haplogroup I1. SF11 was classified as I1-Z2699*.[23][24][25][26] SF11 was not assigned to a specific archaeological culture due to the skeleton being found in the Stora Förvar cave on Stora Karlsö. The skeleton is dated to 5500 BC.
• The second is an individual sample labelled BAB5 from Neolithic Hungary.[27] BAB5 was found to have carried 1 of the 312 SNPs that define haplogroup I1. BAB5 may also be classified as I1-Z2699*.[28] BAB5 had a genetic affinity to other contemporary Neolithic farmers of Central Europe.
• Additionally, the third ancient I1 sample is from an individual found in a kurgan burial dating to the late Neolithic Dagger Period in Scandinavia labelled RISE179.[29] RISE179 had a genetic affinity to the populations of the Corded Ware culture and the Unetice culture.[30]
• The fourth ancient I1 sample predating the Nordic Bronze Age is labelled oll009 and was sequenced in the study titled "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon".[31] Oll009 is dated to the Scandinavian late Neolithic and was found in a burial in Sweden. Similar to RISE179, he carried a high percentage of Western Steppe-Herder ancestry and had a genetic affinity to the population of the Battle Axe culture and other populations of the Corded Ware horizon.[32]
• Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia.[33][34][35]Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying Western Steppe Herder ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age.[36][37][38]
• Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as Pitted Ware before becoming assimilated by the Battle Axe culture, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the Funnelbeaker culture in Central Europe. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.
• Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2570 BC.
• According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in Chalcolithic Europe.[2] A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques.[3]
• In 2007, it was suggested that it initially dispersed from the area that is now Denmark.[14] However, Prof. Dr. Kenneth Nordtvedt, Montana State University, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower Elbe basin seems like the heartland of I1".
• Latest results (Sept. 2019) published by Y-Full suggest I1 (I-M253) was formed 27.500 ybp (95 CI: 29.800 ybp – 25.200 ybp) with TMRCA 4.600 ybp (95 CI: 5.200 ybp – 4.000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2570 BC, this likely puts the ancestor of all living I1 men somewhere in Central or Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion.[39][40] This suggests that I1 went from being a rare marker to a rather common one in a rapid burst.[41]
• Structure
• I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [6]
• I-DF29 (DF29/S438); I1a
• I-CTS6364 (CTS6364/Z2336); I1a1
• FGC20030; I1a1a~
• S4767; I1a1a1~
• I-M227; I1a1a1a1a
• A394; I1a1a2~
• Y11221; I1a1a3~
• A5338; I1a1a4~
• CTS10028; I1a1b
• I-L22 (L22/S142); I1a1b1
• CTS11651/Z2338; I1a1b1a~
• I-P109; I1a1b1a1
• I-Y3662; I1a1b1a1e~
• I-S14887; I1a1b1a1e2~
• I-Y11203; I1a1b1a1e2d~
• I-Y29630; I1a1b1a1e2d2~
• CTS6017; I1a1b1a2
• I-L205 (L205.1/L939.1/S239.1); I1a1b1a3
• CTS6868; I1a1b1a4
• I-Z74; I1a1b1a4a
• CTS2208; I1a1b1a4a1~
• I-L287; I1a1b1a4a1a
• I-L258 (L258/S335); I1a1b1a4a1a1
• I-L813; I1a1b1a4a2
• FGC12562; I1a1b1a4a3~
• CTS11603/S4744; I1a1b1b~
• I-L300 (L300/S241); I1a1b1b1a1
• FGC10477/Y13056; I1a1b2
• A8178, A8182, A8200, A8204; I1a1b3~
• F13534.2/Y17263.2; I1a1b4~
• I-Z58 (S244/Z58); I1a2
• I-Z59 (S246/Z59); I1a2a
• I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
• I-Z140 (Z140, Z141)
• I-L338
• I-F2642 (F2642)
• I-Z73
• I-L1302
• I-L573
• I-L803
• I-Z382; I1a2a2
• I-Z138 (S296/Z138, Z139); I1a2b
• I-Z2541
• I-Z63 (S243/Z63); I1a3
• I-BY151; I1a3a
• I-L849.2; I1a3a1
• I-BY351; I1a3a2
• I-CTS10345
• I-Y10994
• I-Y7075
• I-S2078
• I-S2077
• I-Y2245 (Y2245/PR683)
• I-L1237
• I-FGC9550
• I-S10360
• I-S15301
• I-Y7234
• I-BY62 (BY62); I1a3a3
• I-Z131 (Z131/S249); I1b
• I-CTS6397; I1b1
• I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c
• Historical expansion
• A timeline of the early Germanic expansions
• Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with Germanic peoples and are linked to the proto-Germanic speakers of the Nordic Bronze Age.[42][43] Current DNA research indicates that I1 was close to non-existent in most of Europe outside of Scandinavia and northern Germany before the Migration Period. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanics migrated across the Baltic Sea and settled alongside the Vistula. Germanic migration to that area resulted in the formation of the Wielbark culture, which is associated with the Goths.[44]
• I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the Roman Iron Age. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. [45] The Kowalewko archeological site has been associated with the Wielbark culture. Therefore the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and Lombard remains in Collegno, Italy.[46][47] The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.
• In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300-400 AD from Saxony-Anhalt in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe.[48]
• Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234.[49] Material findings associated with the Lombards have been excavated in Crypta Balbi.
• The Pla de l'Horta villa near Girona in Spain is located in close proximity to a necropolis with a series of tombs associated with the Visigoths. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1.[50] This finding is in accordance with the common ancestral origin of the Visigoths and the Ostrogoths.
• The Anglo-Saxon settlement of Britain introduced I1 in the British Isles.[51]
• During the Viking Age, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia.[52]
• Geographical distribution
• I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the Migration Period, the Viking Age, or modern times. It is found in all places invaded by the Norse.
• During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the United States, Australia, New Zealand and Canada.
• Population Sample size I (total) I1 (I-M253) I1a1a (I-M227) Source
• Albanians (Tirana) 55 21.82%=(12/55) 3.6%=(2/55) 0.0 Battaglia et al. 2008
• Albanians (North Macedonia) 64 17.2%=(11/64) 4.7%=(3/64) 0.0 Battaglia et al. 2008
• Albanians (Tirana)
• Albanians (North Macedonia) 55+64=119 19.33%=(23/119) 4.2%=(5/119) 0.0 Battaglia et al. 2008
• Kosovo Albanians (Pristina) 114 7.96%=(9/114) 5.31%=(6/114) 0.0 Pericic et al. 2005
• Albanians (Tirana)
• Albanians (North Macedonia)
• Kosovo Albanians (Pristina) 55+64+114=233 13.73%=(32/233) 4.72%=(11/233) 0.0 Pericic et al. 2005
• Battaglia et al. 2008
• Austria 43 9.3 2.3 0.0 Underhill et al. 2007
• Belarus: Vitbsk 100 15 1.0 0.0 Underhill et al. 2007
• Belarus: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
• Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
• Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
• Czech Republic 47 31.9 8.5 0.0 Underhill et al. 2007
• Czech Republic 53 17.0 1.9 0.0 Rootsi et al. 2004
• Denmark 122 39.3% (48/122) 32.8% (40/122) 0.0 Underhill et al. 2007
• England 104 19.2 15.4 0.0 Underhill et al. 2007
• Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
• Estonia 118 11.9 Lappalainen et al. 2008
• Finland (national) 28.0 Lappalainen et al. 2006
• Finland: West 230 40% (92/230) Lappalainen et al. 2008
• Finland: East 306 19% (58/306) Lappalainen et al. 2008
• Finland: Satakunta region 50+ Lappalainen et al. 20089
• France 58 17.2 8.6 1.7 Underhill et al. 2007
• France 12 16.7 16.7 0.0 Cann et al. 2002
• France (Low Normandy) 42 21.4 11.9 0.0 Rootsi et al. 2004
• Germany 125 24 15.2 0.0 Underhill et al. 2007
• Greece 171 15.8 2.3 0.0 Underhill et al. 2007
• Hungary 113 25.7 13.3 0.0 Rootsi et al. 2004
• Ireland 100 11 6.0 0.0 Underhill et al. 2007
• Kazan Tatars 53 13.2 11.3 0.0 Trofimova 2015
• Latvia 113 3.5 Lappalainen et al. 2008
• Lithuania 164 4.9 Lappalainen et al. 2008
• Netherlands 93 20.4 14 0.0 Underhill et al. 2007
• Norway 1766 37% (653/1766) Stenersen et al 2006
• Russia (national) 16 25 12.5 0.0 Cann et al. 2002
• Russia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
• Russia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
• Russia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
• Russia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
• Russia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
• Russia: Cossacks 89 24.7 4.5 0.0 Underhill et al. 2007
• Russia: Karelians 140 10 8.6 0.0 Underhill et al. 2007
• Russia: Karelians 132 15.2 Lappalainen et al. 2008
• Russia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
• Slovakia 70 14.3 4.3 0.0 Rootsi et al. 2004
• Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
• Sweden (national) 160 35.6% (57/160) Lappalainen et al. 2008
• Sweden (national) 38.0 Lappalainen et al. 2009
• Sweden: Västra Götaland 52 Lappalainen et al. 2009
• Switzerland 144 7.6 5.6 0.0 Rootsi et al. 2004
• Turkey 523 5.4 1.1 0.0 Underhill et al. 2007
• Ukraine: Lviv 101 23.8 4.9 0.0 Underhill et al. 2007
• Ukraine: Ivanovo-Frankiv 56 21.4 1.8 0.0 Underhill et al. 2007
• Ukraine: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
• Ukraine: Cherkasy 114 28.1 4.3 0.0 Underhill et al. 2007
• Ukraine: Bilhorod 56 26.8 5.3 0.0 Underhill et al. 2007
• Map showing the distribution of Y chromosomes in a trans section of England and Wales from the paper "Y Chromosome Evidence for Anglo-Saxon Mass Migration". The authors attribute the differences in frequencies of haplogroup I1 to Anglo-Saxon mass migration into England, but not into Wales.
• In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from northern Germany and Denmark during the Migration Period.[53] The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the North Sea with Anglo-Saxon migrations and Danish Vikings. The main claim by the researchers was
• that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number … This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea … These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.
• Distribution of Y chromosome haplogroups from Capelli et al. (2003). Haplogroup I-M253 is present in all populations, with higher frequencies in the east and lower frequencies in the west. There appears to be no discrete boundary as observed by Weale et al. (2002)
• In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues.[54] This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.
• Prominent members of I-M253
• Main article: List of haplogroups of historical and famous figures
• Alexander Hamilton, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.[55]
• The Varangian Šimon, who was said to have been the founder of the Russian Vorontsov noble family, belonged to haplogroup I1-Y15024.[56][57] Testing by geneticist Peter Sjölund and FamilyTreeDNA showed that the present-day male members of the Vorontsov family still carry this subclade of I1, and downstream subclades.[58][59] Some prominent historical members of the Vorontsov family were Prince Mikhail Semyonovich Vorontsov, a Russian prince and field-marshal, as well as Count Illarion Ivanovich Vorontsov-Dashkov, a general of the Russian Empire.
• The Rurikid Prince Sviatopolk the Accursed (son of Vladimir the Great) was found to likely have carried the I1-S2077 subclade of I1-Z63.[60][61][62]
• Birger Jarl, 'Duke of Sweden' of the East Geatish House of Bjälbo, founder of Stockholm; his remains were exhumed and tested in 2002 and found to be I-M253.[63] The House of Bjälbo also provided three kings of Norway, and one king of Denmark in the 14th century.
• Sting was revealed to belong to haplogroup I1 by the PBS TV series Finding Your Roots.[64]
• William Bradford (governor) of the Mayflower, proven through the Mayflower DNA Project[65]
• William Brewster (Mayflower passenger) of the Mayflower, proven through the Mayflower DNA Project[65]
• General Robert E. Lee belonged to I-M253 based on DNA testing of his descendants as a part of the Lee DNA Project. Other prominent members of the Lee family of Virginia and Maryland were Richard Lee I and Richard Henry Lee. The latter was one of the Founding Fathers of the United States of America.[66]
• Robert I of Scotland, commonly known as Robert the Bruce, belonged to haplogroup I1. Descendant testing of Robert, 6th lord of Annandale de Brus, assigned the men of Clan Bruce to I1-Y17395.[67]
• The male members of the House of Grimaldi were revealed to carry haplogroup I1 as a part of the Grimaldi Genealogy DNA project.[68] They were lords and princes of Monaco up until 1949. The men of House Grimaldi belong to a Scandinavian subclade of I1, downstream of I1-Y3549.
• President Andrew Jackson belonged to haplogroup I1, based on results from the Jackson DNA project and from genealogy.[69][70]
• The Russian writer Leo Tolstoy was found to have carried I1. The testing of his male descendant Pyotr Tolstoy revealed that the males of the Tolstoy family carry I1-M253.[71][72]
• Snorri Sturluson was found to likely have belonged to haplogroup I1. Y-DNA testing of his presumed descendants revealed an assignment to I-M253. Their results are available on YSearch.org.[71]
• The Swedish scientist and theologian Emanuel Swedenborg and other male members of the Swedenborg noble family were found to belong to haplogroup I1-BY229, as a part of the I1-L1302 DNA project by Jakob Norstedt.[73][74]
• Siener van Rensburg, Boer patriotic figure and mystic, belonged to haplogroup I1.[75][76]
• Björn Wahlroos, Finnish businessman and millionaire, was found to belong to haplogroup I1.[71]
• The Finnish mathematician Rolf Nevanlinna belonged to I1-M253 based on the testing of his son Arne Nevanlinna by Geni.com.[77][78][79]
• Samuel Morse was found to have carried haplogroup I1 as a part of the Morse DNA project.[80][81][82]
• Footballers Sebastian Larsson and his father Svante Larsson were found to belong to I1-Y24470 through the testing of a family member.[83][84][85][86]
• Felix Kjellberg (PewDiePie) was found to belong to haplogroup I1-L22, according to testing by 23andMe.[87]
• Swedish actor Björn Andrésen belongs to haplogroup I1-L22 based on the ftDNA and 23andMe tests of one of his first cousins and one uncle on the paternal side as a part of their family research.[88][89][90][91]Their ancestor Johan Andrésen lived on both sides of the Swedish-Norwegian border.[92][93]
• As a part of the Pine family DNA project, actor Chris Pine was found to belong to haplogroup I1-A13819.[94][95]
• Markers
• DNA example: strand 1 differs from strand 2 at a single base pair location (a C >> T polymorphism).
• The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.
• Name: M253[96]
• Type: SNP
• Source: M (Peter Underhill of Stanford University)
• Position: ChrY:13532101..13532101 (+ strand)
• Position (base pair): 283
• Total size (base pairs): 400
• Length: 1
• ISOGG HG: I1
• Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
• Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
• YCC HG: I1
• Nucleotide alleles change (mutation): C to T
• Name: M307[97]
• Type: SNP
• Source: M (Peter Underhill)
• Position: ChrY:21160339..21160339 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: TTATTGGCATTTCAGGAAGTG
• Primer R: GGGTGAGGCAGGAAAATAGC
• YCC HG: I1
• Nucleotide alleles change (mutation): G to A
• Name: P30[98]
• Type: SNP
• Source: PS (Michael Hammer of the University of Arizona and James F. Wilson, at the University of Edinburgh)
• Position: ChrY:13006761..13006761 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: GGTGGGCTGTTTGAAAAAGA
• Primer R: AGCCAAATACCAGTCGTCAC
• YCC HG: I1
• Nucleotide alleles change (mutation): G to A
• Region: ARSDP
• Name: P40[99]
• Type: SNP
• Source: PS (Michael Hammer and James F. Wilson)
• Position: ChrY:12994402..12994402 (+ strand)
• Length: 1
• ISOGG HG: I1
• Primer F: GGAGAAAAGGTGAGAAACC
• Primer R: GGACAAGGGGCAGATT
• YCC HG: I1
• Nucleotide alleles change (mutation): C to T
• Region: ARSDP
• See also
• European ethnic groups
• Genetic history of Europe
• Germanic peoples
• History of Normandy
• Human Y-chromosome DNA haplogroups
• Late Glacial Maximum
• Neolithic Europe
• Norse colonization of the Americas
• Norse Sagas
• References
• https://yfull.com/tree/I1/
• Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
• Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6: 7152. doi:10.1038/ncomms8152. PMC 4441248. PMID 25988751.
• Rootsi S, Magri C, Kivisild T, Benuzzi G, Help H, Bermisheva M, et al. (July 2004). "Phylogeography of Y-chromosome haplogroup I reveals distinct domains of prehistoric gene flow in europe" (PDF). American Journal of Human Genetics. 75 (1): 128–37. doi:10.1086/422196. PMC 1181996. PMID 15162323. Archived from the original (PDF) on 2009-06-24. Retrieved 2008-03-20.
• P.A. Underhill, N.M. Myres, S. Rootsi, C.T. Chow, A.A. Lin, R.P. Otillar, R. King, L.A. Zhivotovsky, O. Balanovsky, A. Pshenichnov, K.H. Ritchie, L.L. Cavalli-Sforza, T. Kivisild, R. Villems, S.R. Woodward, New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in P. Mellars, K. Boyle, O. Bar-Yosef and C. Stringer (eds.), Rethinking the Human Evolution (2007), pp. 33–42.
• ISOGG, Y-DNA Haplogroup I and its Subclades – 2017 (31 January 2017).
• Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
• Lappalainen T, Hannelius U, Salmela E, von Döbeln U, Lindgren CM, Huoponen K, et al. (January 2009). "Population structure in contemporary Sweden--a Y-chromosomal and mitochondrial DNA analysis". Annals of Human Genetics. 73 (1): 61–73. doi:10.1111/j.1469-1809.2008.00487.x. PMID 19040656. S2CID 205598345.
• https://www.familytreedna.com/public/Sweden?iframe=ymap
• Lappalainen T, Laitinen V, Salmela E, Andersen P, Huoponen K, Savontaus ML, Lahermo P (May 2008). "Migration waves to the Baltic Sea region". Annals of Human Genetics. 72 (Pt 3): 337–48. doi:10.1111/j.1469-1809.2007.00429.x. PMID 18294359. S2CID 32079904.
• Dupuy BM, Stenersen M, Lu TT, Olaisen B (December 2006). "Geographical heterogeneity of Y-chromosomal lineages in Norway". Forensic Science International. 164 (1): 10–9. doi:10.1016/j.forsciint.2005.11.009. PMID 16337760.
• "FamilyTreeDNA - The Norway DNA Project - Norgesprosjektet". www.familytreedna.com. Retrieved 2020-11-26.
• "Y-DNA Haplogrupper". Norway DNA Norgesprosjektet. Retrieved 2020-12-27.
• Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.
• Sanchez JJ (2004). "Y chromosome SNP haplogroups in Danes, Greenlanders and Somalis" (PDF). International Congress Series. 1261: 347–349. doi:10.1016/S0531-5131(03)01635-2 – via isfg.org.
• "FamilyTreeDNA - Denmark DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Estimating Scandinavian and Gaelic Ancestry in the Male Settlers of Iceland". The American Journal of Human Genetics. 67 (3): 697–717. 2000-09-01. doi:10.1086/303046. ISSN 0002-9297.
• "The Greater Nordic Regional Y-DNA Project". familytreedna. April 2021.
• Ebenesersdóttir, S. Sunna; Sandoval-Velasco, Marcela; Gunnarsdóttir, Ellen D.; Jagadeesan, Anuradha; Guðmundsdóttir, Valdís B.; Thordardóttir, Elísabet L.; Einarsdóttir, Margrét S.; Moore, Kristjan H. S.; Sigurðsson, Ásgeir; Magnúsdóttir, Droplaug N.; Jónsson, Hákon (2018-06-01). "Ancient genomes from Iceland reveal the making of a human population". Science (New York, N.Y.). 360 (6392): 1028–1032. doi:10.1126/science.aar2625. ISSN 1095-9203. PMID 29853688.
• Lappalainen T., Koivumäki S., Salmela E., Huoponen K., Sistonen P., Savontaus M.L., Lahermo P.; 2006, "Regional differences among the Finns: a Y-chromosomal perspective", Gene vol. 376, no. 2, pp. 207–15.
• "Blood of the Isles: exploring the genetic roots of our tribal history". History Ireland. 2013-02-22. Retrieved 2020-12-10.
• Karafet TM, Mendez FL, Meilerman MB, Underhill PA, Zegura SL, Hammer MF (May 2008). "New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree". Genome Research. 18 (5): 830–8. doi:10.1101/gr.7172008. PMC 2336805. PMID 18385274.
• Gunther T (2017). "Genomics of Mesolithic Scandinavia reveal colonization routes and high-latitude adaptation" (PDF). Nature. 23: 6 – via Biorxiv.
• SF11 - Stora Förvar, Stora Karlsö I-Z2699*. "Haplotree.info sample: SF11". haplotree.info.
• Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014). "Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers". Science. 344 (6185): 747–50. Bibcode:2014Sci...344..747S. doi:10.1126/science.1253448. PMID 24762536. S2CID 206556994.
• "familytreedna.com I-Z2699 tree". familytreedna. April 2021.
• Szécsényi-Nagy A, Brandt G, Haak W, Keerl V, Jakucs J, Möller-Rieker S, et al. (April 2015). "Tracing the genetic origin of Europe's first farmers reveals insights into their social organization". Proceedings. Biological Sciences. 282 (1805). doi:10.1098/rspb.2015.0339. PMC 4389623. PMID 25808890.
• 5&ybp=500000,0 "BAB5 I-Z2699*" Check |url= value (help). haplotree.info.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• "YFull | The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". www.yfull.com. Retrieved 2021-01-24.
• Malmstrom H (July 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon" (PDF). Uppsala Genomics. 1: 3 – via jakobssonlab.iob.uu.se/.
• Sánchez-Quinto F, Malmström H, Fraser M, Girdland-Flink L, Svensson EM, Simões LG, et al. (May 2019). "Megalithic tombs in western and northern Neolithic Europe were linked to a kindred society". Proceedings of the National Academy of Sciences of the United States of America. 116 (19): 9469–9474. doi:10.1073/pnas.1818037116. PMC 6511028. PMID 30988179.
• Malmström H, Linderholm A, Skoglund P, Storå J, Sjödin P, Gilbert MT, et al. (January 2015). "Ancient mitochondrial DNA from the northern fringe of the Neolithic farming expansion in Europe sheds light on the dispersion process". Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences. 370 (1660): 20130373. doi:10.1098/rstb.2013.0373. PMC 4275881. PMID 25487325.
• Skoglund P, Malmström H, Omrak A, Raghavan M, Valdiosera C, Günther T, et al. (May 2014). "Genomic diversity and admixture differs for Stone-Age Scandinavian foragers and farmers". Science. 344 (6185): 747–50. Bibcode:2014Sci...344..747S. doi:10.1126/science.1253448. PMID 24762536. S2CID 206556994.
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. Bibcode:2015Natur.522..167A. doi:10.1038/nature14507. PMID 26062507. S2CID 4399103.
• Karlsson AO, Wallerström T, Götherström A, Holmlund G (August 2006). "Y-chromosome diversity in Sweden - a long-time perspective". European Journal of Human Genetics. 14 (8): 963–70. doi:10.1038/sj.ejhg.5201651. PMID 16724001. S2CID 23227271.
• Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, et al. (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
• Poznik GD, Xue Y, Mendez FL, Willems TF, Massaia A, Wilson Sayres MA, et al. (June 2016). "Punctuated bursts in human male demography inferred from 1,244 worldwide Y-chromosome sequences". Nature Genetics. 48 (6): 593–9. doi:10.1038/ng.3559. hdl:11858/00-001M-0000-002A-F024-C. PMC 4884158. PMID 27111036.
• Woodley M (February 2017). "Holocene selection for variants associated with cognitive ability: Comparing ancient and modern genomes" (PDF). www.biorxiv.org/. doi:10.1101/109678. S2CID 196631764. Retrieved 27 January 2021.
• Batini C, Hallast P, Zadik D, Delser PM, Benazzo A, Ghirotto S, et al. (May 2015). "Large-scale recent expansion of European patrilineages shown by population resequencing". Nature Communications. 6: 7152. Bibcode:2015NatCo...6.7152B. doi:10.1038/ncomms8152. PMC 4441248. PMID 25988751.
• Schmidt KH (1991). "The Celts and the Ethnogenesis of the Germanic People". Historische Sprachforschung / Historical Linguistics. 104 (1): 129–152. ISSN 0935-3518. JSTOR 40849016.
• Bergerbrant S (May 2007). "Bronze Age Identities: Costume, Conflict and Contact in Northern Europe 1600–1300 BC" (PDF). Stockholm Studies in Archaeology. 43: 7–201 – via diva-portal.org.
• Teska M, Michalowski A (2014). "Connection between Wielkopolska and the Baltic Sea Region in the Roman Iron Age". www.semanticscholar.org. S2CID 56295624. Retrieved 2020-12-10.
• Zenczak M, Handschuh L, Juras A, Marcinkowska-Swojak M, Philips A, Piontek J, Stolarek I, Figlerowicz M (2017). Y-Chromosome Haplogroup Assignment Through Next Generation Sequencing of Enriched Ancient DNA Libraries. Anthropological Genetics. p. Presentation number: AG 16.
• Amorim CE, Vai S, Posth C, Modi A, Koncz I, Hakenbeck S, et al. (September 2018). "Understanding 6th-century barbarian social organization and migration through paleogenomics". Nature Communications. 9 (1): 3547. Bibcode:2018NatCo...9.3547A. doi:10.1038/s41467-018-06024-4. PMC 6134036. PMID 30206220.
• Estes R (2020-10-16). "Longobards Ancient DNA from Pannonia and Italy – What Does Their DNA Tell Us? Are You Related?". DNAeXplained - Genetic Genealogy. Retrieved 2020-12-11.
• Labudde D (July 2015). "Gender distribution of excavation finds from the Roman imperial and migration period". ResearchGate. 1: 2 – via ResearchGate.net.
• Antonio ML, Gao Z, Moots HM, Lucci M, Candilio F, Sawyer S, et al. (November 2019). "Ancient Rome: A genetic crossroads of Europe and the Mediterranean". Science. 366 (6466): 708–714. Bibcode:2019Sci...366..708A. doi:10.1126/science.aay6826. PMC 7093155. PMID 31699931.
• Olalde I, Mallick S, Patterson N, Rohland N, Villalba-Mouco V, Silva M, et al. (March 2019). "The genomic history of the Iberian Peninsula over the past 8000 years". Science. 363 (6432): 1230–1234. Bibcode:2019Sci...363.1230O. doi:10.1126/science.aav4040. PMC 6436108. PMID 30872528.
• Martiniano R, Caffell A, Holst M, Hunter-Mann K, Montgomery J, Müldner G, et al. (January 2016). "Genomic signals of migration and continuity in Britain before the Anglo-Saxons". Nature Communications. 7 (1): 10326. Bibcode:2016NatCo...710326M. doi:10.1038/ncomms10326. PMC 4735653. PMID 26783717.
• Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–396. doi:10.1101/703405. PMID 32939067. S2CID 201195157.
• Weale ME, Weiss DA, Jager RF, Bradman N, Thomas MG (July 2002). "Y chromosome evidence for Anglo-Saxon mass migration". Molecular Biology and Evolution. 19 (7): 1008–21. doi:10.1093/oxfordjournals.molbev.a004160. PMID 12082121.
• Capelli C, Redhead N, Abernethy JK, Gratrix F, Wilson JF, Moen T, et al. (May 2003). "A Y chromosome census of the British Isles". Current Biology. 13 (11): 979–84. doi:10.1016/S0960-9822(03)00373-7. PMID 12781138. S2CID 526263.
• "Founding Father DNA". isogg.org.
• "FamilyTreeDNA - Genetic Testing for Ancestry, Family History & Genealogy". www.familytreedna.com. Retrieved 2020-12-10.
• "Faderslinjen, DNA". www.sikaby.se. Retrieved 2020-12-10.
• "FamilyTreeDNA - RussiaDNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Vår vikingahövding i österled". www.sikaby.se. Retrieved 2020-12-10.
• "Sample from Homo sapiens - BioSample - NCBI". www.ncbi.nlm.nih.gov. Retrieved 2020-12-10.
• Margaryan A, Lawson DJ, Sikora M, Racimo F, Rasmussen S, Moltke I, et al. (September 2020). "Population genomics of the Viking world". Nature. 585 (7825): 390–396. Bibcode:2020Natur.585..390M. doi:10.1038/s41586-020-2688-8. PMID 32939067.
• Duczko W (2004-01-01). Viking Rus: Studies on the Presence of Scandinavians in Eastern Europe. BRILL. ISBN 978-90-04-13874-2.
• Malmström H, Vretemark M, Tillmar A, Durling MB, Skoglund P, Gilbert MT, et al. (January 2012). "Finding the founder of Stockholm - a kinship study based on Y-chromosomal, autosomal and mitochondrial DNA". Annals of Anatomy = Anatomischer Anzeiger. Special Issue: Ancient DNA. 194 (1): 138–45. doi:10.1016/j.aanat.2011.03.014. PMID 21596538.
• The British Invasion Finding Your Roots
• "Mayflower DNA Project". mayflowerdna.org. Retrieved 2020-11-23.
• "FamilyTreeDNA - Lee Surname DNA Research Project (and Leigh, Lea, etc)". www.familytreedna.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - I1-S4795". www.familytreedna.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - GRIMALDI GENEALOGY PROJECT at FtDNA". www.familytreedna.com. Retrieved 2020-12-11.
• "Jackson DNA Project". FamilyTreeDNA. 11 December 2020.
• Hay M (July 2020). "Origins and history of Haplogroup I1 (Y-DNA)". ResearchGate. 1: 9.
• Maciamo E. "Haplogroup I1 (Y-DNA)". Eupedia. Retrieved 2020-12-11.
• Петр Толстой. Моя родословная. Выпуск от 18.04.2010 (in Russian), retrieved 2020-12-15
• "I-BY229 YTree". yfull.com. Retrieved 2020-12-10.
• "Swedenborg". Höijen (in Swedish). Retrieved 2020-12-10.
• "Claas Jansz van Rensburg, SV/PROG". geni_family_tree. Retrieved 2021-01-03.
• "janse /jansen van Rensburg I-M253 genealogy discussion". geni_family_tree. Retrieved 2021-01-03.
• "Rolf H. Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
• olenus (2018-03-30). "I1: Rolf Nevanlinna (né Neovius)". Descendants of haplogroup IJ-M429. Retrieved 2020-12-26.
• "Arne Edvard Nevanlinna". geni_family_tree. Retrieved 2020-12-26.
• "Morse/Moss DNA Testing". morsesociety.org. Retrieved 2020-12-10.
• "FamilyTreeDNA - Morse / Moss DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "Peter Morse's Family Tree". www.geni.com. Retrieved 2020-12-10.
• "FamilyTreeDNA - Sweden DNA PROJECT - Sverigeprojektet". www.familytreedna.com. Retrieved 2021-02-14.
• "Eskilstuna kommun · EM GN398 - Familjen Larsson, Torshälla ca 1900". Eskilstuna kommun (in Swedish). Retrieved 2021-02-14.
• "I-Y24470 YTree". www.yfull.com. Retrieved 2021-02-14.
• "Familjen Larssons Anfäder". hosserudkullen.se. Retrieved 2021-02-14.
• https://www.youtube.com/watch?v=sLJ9my42vR4
• "FamilyTreeDNA - The Norway DNA Project - Norgesprosjektet". www.familytreedna.com. Retrieved 2021-02-02.
• Tovseth A (June 2018). "Andrésen, Färnskog & Hansen family research". Kjellivar.tripod.com. Retrieved 2 February 2021.
• "Personer med namnet Andresen | Släktingar.se". www.slaktingar.se. Retrieved 2021-02-02.
• "BJÖRN ANDRESEN: Min passion för mamma blev aldrig besvarad - Katarina Hahr möter". Radio Sveriges (in Swedish). Retrieved 2021-02-02.
• "Johan Peter Andresen - Ancestry". www.ancestry.se. Retrieved 2021-02-02.
• "Family tree of Daniel ANDRESEN". Geneanet. Retrieved 2021-02-02.
• "FamilyTreeDNA - Pine/Pyne Genealogy DNA Project". www.familytreedna.com. Retrieved 2020-12-10.
• "James Pine, Sr". geni_family_tree. Retrieved 2020-12-10.
• snpdev. "Reference SNP (refSNP) Cluster Report: rs9341296". nih.gov.
• snpdev. "Reference SNP (refSNP) Cluster Report: rs13447354". nih.gov.
• P30[permanent dead link]
• P40[permanent dead link]
• Further reading
• Allentoft ME, Sikora M, Sjögren KG, Rasmussen S, Rasmussen M, Stenderup J, et al. (June 2015). "Population genomics of Bronze Age Eurasia". Nature. 522 (7555): 167–72. doi:10.1038/nature14507. PMID 26062507.
• Brunel S, Bennett EA, Cardin L, Garraud D, Barrand Emam H, Beylier A, et al. (June 2020). "Ancient genomes from present-day France unveil 7,000 years of its demographic history". Proceedings of the National Academy of Sciences of the United States of America. 117 (23): 12791–12798. doi:10.1073/pnas.1918034117. PMC 7293694. PMID 32457149.</ref>
• Malmström H, Gilbert MT, Thomas MG, Brandström M, Storå J, Molnar P, et al. (November 2009). "Ancient DNA reveals lack of continuity between neolithic hunter-gatherers and contemporary Scandinavians". Current Biology. 19 (20): 1758–62. doi:10.1016/j.cub.2009.09.017.
• Malmström H, Günther T, Svensson EM, Juras A, Fraser M, Munters AR, Pospieszny Ł, Tõrv M, Lindström J, Götherström A, Storå J, Jakobsson M (October 2019). "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Proceedings. Biological Sciences. 286 (1912): 20191528. doi:10.1098/rspb.2019.1528. PMC 6790770. PMID 31594508.
• Villalba-Mouco V, van de Loosdrecht MS, Posth C, Mora R, Martínez-Moreno J, Rojo-Guerra M, et al. (April 2019). "Survival of Late Pleistocene Hunter-Gatherer Ancestry in the Iberian Peninsula". Current Biology. Cell Press. 29 (7): 1169–1177.e7. doi:10.1016/j.cub.2019.02.006. PMID 30880015. S2CID 76663708.
• External links
• Haplogroup I databases
• Haplogroup I1 Project at FTDNA
• Danish Demes Regional DNA Project at FTDNA
• Haplogroup I-P109 Project
• British Isles DNA Project
• General Y-DNA databases
• There are several public access databases featuring I-M253, including:
• http://www.ysearch.org/
• http://www.yhrd.org/
• http://www.yfull.com/

tree/I1/

Haplogroupe I-M253

• I1 (M253)
• Description de l'image HG I1 europa.jpg.
• Caractéristiques Date d'origine 3170–5070 av. J.-C. (précédemment 11000 av. J.-C. à 33000 av. J.-C.)
• Place d'origine Europe du Nord
• Ancêtre I* (M170)
• Descendants I1a (DF29/S438);
• I1b (S249/Z131);
• I1c (Y18119/Z17925)
• Mutations définies M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, L187
• modifier Consultez la documentation du modèle
• L'haplogroupe I-M253, aussi connu comme I1, est un haplogroupe du chromosome Y. Les marqueurs génétiques identifiants confirmés de I-M253 sont les SNP's M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, et L187. C'est une branche primaire de l'Haplogroupe I-M170 (I*).
• L'haplogroupe atteint ses fréquences de pointe en Suède (52 % des hommes dans le comté de Västra Götaland) et à l'ouest de la Finlande (plus de 50 % dans la province de Satakunta)1 En termes de moyennes nationales, I-M253 se situe entre 35 et 38 % des hommes suédois2, 32,8 % des hommes danois, environ 31,5 % des mâles norvégiens3 et environ 28 % des hommes finlandais.
• L'haplogroupe I-M253 est une branche primaire de l'haplogroupe I* (I-M170), qui a été présente en Europe depuis l'antiquité. L'autre branche primaire de I* est-I-M438, également connue comme I2.
• Avant un reclassement en 20084, le groupe était connu comme I1a, un nom qui a depuis été réaffecté à une branche primaire, l'haplogroupe I-DF29. Les autres principales branches de I1 (M253) sont I1b (S249/Z131) et I1c (Y18119/Z17925).
• Sommaire
• 1 Origines
• 2 Structure
• 3 Répartition géographique
• 3.1 Suède
• 3.2 Danemark
• 3.3 Norvège
• 3.4 Finlande
• 3.5 Grande-Bretagne
• 4 Membres éminents de l'I-M253
• 5 Marqueurs
• 6 Références
• 6.1 Projets
• Origines
• Selon une étude publiée en 2010, I-M253 est apparu entre 3 170 et 5 000 ans, au Chalcolithique en Europe5. Une nouvelle étude en 2015 estime son origine entre 3 470 et 5 070 ans ou entre 3 180 et 3 760, à l'aide de deux techniques différentes6. Il est suggéré qu'il a initialement essaimé à partir de la région qui est maintenant le Danemark7.
• Une étude de 2014 en Hongrie révéla les restes de neuf personnes de la culture rubanée, dont un portait le SNP M253 qui définit l'haplogroupe I1. Cette culture perdure entre 5 500 à 4 700 ans av. J.-C.8.
• Structure
• I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, et L187) ou I1ȉ
• I-DF29 (DF29/S438); I1a
• I-CTS6364 (CTS6364/Z2336); I1a1
• I-M227; I1a1a
• I-L22 (L22/S142); I1a1b
• I-P109; I1a1b1
• I-L205 (L205.1/L939.1/S239.1); I1a1b2
• I-Z74; I1a1b3
• I-L300 (L300/S241); I1a1b4
• I-L287
• I-L258 (L258/S335)
• I-L813
• I-Z58 (S244/Z58); I1a2
• I-Z59 (S246/Z59); I1a2a
• I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
• I-Z140 (Z140, Z141)
• I-L338
• I-F2642 (F2642)
• I-Z73
• I-L1302
• I-L573
• I-L803
• I-Z382; I1a2a2
• I-Z138 (S296/Z138, Z139); I1a2b
• I-Z2541
• I-Z63 (S243/Z63); I1a3
• I-BY151; I1a3a
• I-L849.2; I1a3a1
• I-BY351; I1a3a2
• I-CTS10345
• I-Y10994
• I-Y7075
• I-S2078
• I-S2077
• I-Y2245 (Y2245/PR683)
• I-L1237
• I-FGC9550
• I-S10360
• I-S15301
• I-Y7234
• I-BY62 (BY62); I1a3a3
• I-Z131 (Z131/S249); I1b
• I-CTS6397; I1b1
• I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c
• Répartition géographique
• I-M253 est trouvé à densité élevée dans le Nord de l'Europe et d'autres pays qui ont subi d'importantes migrations de l'Europe du Nord, soit dans la Période de Migration, la période Viking de ou de l'époque moderne. On le trouve dans tous les endroits envahis par les anciens Germains et les Vikings.
• Au cours de l'ère moderne, d'importants populations I-M253 ont d'ailleurs pris racine dans des pays d'immigration et anciennes colonies européennes telles que les États-Unis, l'Australie et le Canada.
• Population Taille de l'échantillon I (total) I1 (I-M253) I1a1a (I-M227) Source
• Autriche 43 9.3 2.3 0.0 Underhill et al. 2007
• Biélorussie: Vitebsk 100 15 1.0 0.0 Underhill et al. 2007
• Biélorussie: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
• Bosnie 100 42 2.0 0.0 Rootsi et al. 2004
• Bulgarie 808 26.6 4.3 0.0 Karachanak et al. 2013
• République Tchèque 47 31.9 8.5 0.0 Underhill et al. 2007
• République Tchèque 53 17.0 1.9 0.0 Rootsi et al. 2004
• Danemark 122 39.3 32.8 0.0 Underhill et al. 2007
• Angleterre 104 19.2 15.4 0.0 Underhill et al. 2007
• Estonie 210 18.6 14.8 0.5 Rootsi et al. 2004
• Estonie 118 11.9 Lappalainen et al. 2008
• Finlande (national) 28.0 Lappalainen et al. 2006
• Finlande: ouest 230 40 Lappalainen et al. 2008
• Finlande: est 306 19 Lappalainen et al. 2008
• Finlande: région de Satakunta 50+ Lappalainen et al. 20089
• France 58 17.2 8.6 1.7 Underhill et al. 2007
• France 12 16.7 16.7 0.0 Cann et al. 2002
• France (Basse-Normandie) 42 21.4 11.9 0.0 Rootsi et al. 2004
• Allemagne 125 24 15.2 0.0 Underhill et al. 2007
• Grèce 171 15.8 2.3 0.0 Underhill et al. 2007
• Hongrie 113 25.7 13.3 0.0 Rootsi et al. 2004
• Irlande 100 11 6.0 0.0 Underhill et al. 2007
• Tatars de Kazan 53 13.2 11.3 0.0 Trofimova 2015
• Lettonie 113 3.5 Lappalainen et al. 2008
• Lituanie 164 4.9 Lappalainen et al. 2008
• Pays-Bas 93 20.4 14 0.0 Underhill et al. 2007
• Norvège 2826 31.5 Eupedia 2017 [r%C3%A9f. à confirmer]
• Russie (national) 16 25 12.5 0.0 Cann et al. 2002
• Russie: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
• Russie: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
• Russie: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
• Russie: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
• Russie: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
• Russie: Cossaques 89 24.7 4.5 0.0 Underhill et al. 2007
• Russie: Caréliens 140 10 8.6 0.0 Underhill et al. 2007
• Russie: Caréliens 132 15.2 Lappalainen et al. 2008
• Russie: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
• Slovaquie 70 14.3 4.3 0.0 Rootsi et al. 2004
• Slovénie 95 26.3 7.4 0.0 Underhill et al. 2007
• Suède (national) 160 35.6 Lappalainen et al. 2008
• Suède (national) 38.0 Lappalainen et al. 2009
• Suède: Västra Götaland 52 Lappalainen et al. 2009
• Suisse 144 7.6 5.6 0.0 Rootsi et al. 2004
• Turquie 523 5.4 1.1 0.0 Underhill et al. 2007
• Ukraine: Lvov 101 23.8 4.9 0.0 Underhill et al. 2007
• Ukraine: Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill et al. 2007
• Ukraine: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
• Ukraine: Cherkassy 114 28.1 4.3 0.0 Underhill et al. 2007
• Ukraine: Belgorod 56 26.8 5.3 0.0 Underhill et al. 2007
• Suède
• Danemark
• Norvège
• Finlande
• Grande-Bretagne
• Carte montrant la répartition des chromosomes Y en trans-section de l'Angleterre et du pays de Galles à partir de l'étude "Évidence de l'immigration en masse des Anglo-Saxons par le chromosome Y" [archive]. Les auteurs attribuent les différences dans les fréquences de l'haplogroupe I à l'immigration Anglo-Saxonne massive en Angleterre, mais pas au pays de Galles.
• En 2002, un document a été publié par Michael E. Weale et collègues en montrant la preuve génétique des différences entre la population anglaise et galloise, y compris un niveau nettement plus élevé de l'ADN-Y de l'haplogroupe I en Angleterre que dans le pays de Galles. Ils ont vu cela comme une preuve convaincante de l'invasion massive anglo-saxonne de l'est de la Grande-Bretagne à partir de l'Allemagne du nord et du Danemark au cours de la Période de Migration10. Les auteurs ont supposé que les populations avec des grandes proportions d'haplogroupe I furent originaires de l'Allemagne du nord ou du sud de la Scandinavie, en particulier du Danemark, et que leurs ancêtres avaient migré à travers la Mer du Nord avec les migrations des Anglo-Saxons et les Vikings danois. La principale revendication faite par les rechercheurs était:
• qu'un événement d'immigration anglo-saxonne affectant de 50 à 100 % du fonds génétique des hommes de l'Angleterre centrale serait nécessaire à l'époque. Nous observons, toutefois, que nos données ne nous permettent pas de distinguer un événement simplement ajouté au fonds génétique masculin indigène de l'Angleterre centrale, d'un autre où les populations de mâles autochtones étaient déplacés ailleurs, ou bien où le nombre d'hommes autochtones a été réduit ... Cette étude montre que la frontière galloise était plus une barrière génétique aux flux de gènes du chromosome Y anglo-saxon que la Mer du Nord. Ces résultats indiquent qu'une frontière politique peut être plus important qu'une géophysique dans la structuration génétique des populations.
• La Distribution des haplogroupes du chromosome Y de Capelli et coll. (2003). L'haplogroupe I est présent dans toutes les populations, avec des fréquences plus élevées dans l'est et des basses fréquences dans l'ouest. Il ne semble pas exister une limite précise comme observé par Weale et coll. (2002)
• En 2003, un document publié par Christian Capelli et les collègues prit en charge, mais modifié, les conclusions de Weale et collègues11. Ce document, qui a échantillonné sur une grille la Grande-Bretagne et l'Irlande , a trouvé une petite différence entre les échantillons gallois et anglais, avec une diminution progressive de fréquence de l'haplogroupe I en se déplaçant vers l'ouest dans le sud de la Grande-Bretagne. Les résultats suggérèrent aux auteurs que les envahisseurs vikings norvégiens avaient fortement influencé le secteur nord des Îles Britanniques, mais que les deux échantillons anglais et le écossais (de l’île principale) ont tous les deux de l'influence allemande/danoise .
• Membres éminents de l'I-M253
• Alexander Hamilton, par la généalogie et les tests de ses descendants (en supposant être la paternité réelle correspondante de sa généalogie), a été placé dans l'haplogroupe ADN-Y I-M25312.
• Birger Jarl, "Duc de Suède" de la Maison des Goths de Bjalbo, fondateur de Stockholm, dont les vestiges enfouis dans une église avaient été faits tester en 2002 et confirmés aussi I-M253
• Les Passagers du Mayflower William Brewster, Edward Winslow et George Soule grâce à des tests ADN [archive]
• Marqueurs
• ADN, exemple: chaîne 1 ne diffère de la chaîne 2 que par un seul pair de base (polymorphisme C > T).
• Voici les spécifications techniques pour les mutations SNP et STR de I'haplogroupe I-M253.
• Nom: M25313
• Type: SNP
• Source: M (Peter Underhill de « l'Université de Stanford »(Archive • Wikiwix • Archive.is • Google • Que faire ?) (consulté le 8 juillet 2017))
• Position: « ChrY:13532101..13532101 (+ verticale) »(Archive • Wikiwix • Archive.is • Google • Que faire ?) (consulté le 8 juillet 2017)
• Position (paires de bases): 283
• Taille totale (paires de bases): 400
• Longueur: 1
• ISOGG HG: I1
• Amorce F (sense 5'→ 3'): GCAACAATGAGGGTTTTTTTG
• Amorce R (anti-sense 5'→ 3'): CAGCTCCACCTCTATGCAGTTT
• YCC HG: I1
• Changement de nucléotides allèles (mutation): C à T
• Nom: M30714
• Type: SNP
• Source: M (Peter Underhill)
• Position: « ChrY:21160339..21160339 (+ verticale) »(Archive • Wikiwix • Archive.is • Google • Que faire ?) (consulté le 8 juillet 2017)
• Longueur: 1
• ISOGG HG: I1
• Amorce F: TTATTGGCATTTCAGGAAGTG
• Amorce R: GGGTGAGGCAGGAAAATAGC
• YCC HG: I1
• Changement de nucléotides allèles (mutation): G pour A
• Nom: P3015
• Type: SNP
• Source: PS (« Michael Hammer »(Archive • Wikiwix • Archive.is • Google • Que faire ?) (consulté le 8 juillet 2017) de l' Université de l'Arizona [archive] et James F. Wilson [archive], de l'Université d'Édimbourg)
• Position: « ChrY:13006761..13006761 (+ verticale) »(Archive • Wikiwix • Archive.is • Google • Que faire ?) (consulté le 9 juillet 2017)
• Longueur: 1
• ISOGG HG: I1
• Amorce F: GGTGGGCTGTTTGAAAAAGA
• Amorce R: AGCCAAATACCAGTCGTCAC
• YCC HG: I1
• Changement de nucléotides allèles (mutation): G pour A
• Région: ARSDP
• Nom: P4016
• Type: SNP
• Source: PS (Michael Hammer et James F. Wilson)
• Position: « ChrY:12994402..12994402 (+ verticale) »(Archive • Wikiwix • Archive.is • Google • Que faire ?) (consulté le 9 juillet 2017)
• Longueur: 1
• ISOGG HG: I1
• Amorce F: GGAGAAAAGGTGAGAAACC
• Amorce R: GGACAAGGGGCAGATT
• YCC HG: I1
• De nucléotides allèles changement (mutation): C à T
• Région: ARSDP
• Références
• T. Lappalainen, V. Laitinen, E. Salmela et P. Andersen, « Migration Waves to the Baltic Sea Region », Annals of Human Genetics, vol. 72, no 3,‎ 2008, p. 337–348 (PMID 18294359, DOI 10.1111/j.1469-1809.2007.00429.x).
• T. Lappalainen, U. Hannelius, E. Salmela et U. von Döbeln, « Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis », Annals of Human Genetics, vol. 73, no 1,‎ 2009, p. 61–73 (PMID 19040656, DOI 10.1111/j.1469-1809.2008.00487.x).
• (en) Eupedia, Distribution of European Y-chromosome DNA (Y-DNA) haplogroups by country in percentage [archive], 31 janvier 2017.
• Tatiana M. Karafet, F. L. Mendez, M. B. Meilerman et P. A. Underhill, « New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree », Genome Research, vol. 18, no 5,‎ 2008, p. 830–8 (PMID 18385274, PMCID 2336805, DOI 10.1101/gr.7172008).
• (en) Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1 [archive], Family Tree DNA.
• (en) « TMRCAs of major haplogroups in Europe estimated using two methods. : Large-scale recent expansion of European patrilineages shown by population resequencing : Nature Communications : Nature Publishing Group » [archive], sur www.nature.com (consulté le 19 mai 2015).
• (en) Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), p. 33-42.
• (en) Anna Szécsényi-Nagy et al., « Tracing the genetic origin of Europe's first farmers reveals insights into their social organization » [archive], 2015 apr 22.
• ISOGG, Y-DNA Haplogroup I and its Subclades - 2017 [archive] (31 January 2017).
• Michael E. Weale, Deborah A. Weiss, Rolf F. Jager et Neil Bradman, « Y chromosome Evidence for Anglo-Saxon Mass Migration », Molecular Biology and Evolution, vol. 19, no 7,‎ 2002, p. 1008–1021 (PMID 12082121, DOI 10.1093/oxfordjournals.molbev.a004160, lire en ligne [archive]).
• Cristian Capelli, Nicola Redhead, Julia K. Abernethy et Fiona Gratrix, « A Y Chromosome Census of the British Isles », Current Biology, vol. 13, no 11,‎ 2003, p. 979–984 (PMID 12781138, DOI 10.1016/S0960-9822(03)00373-7, lire en ligne [archive] [PDF]).
• « Founding Father DNA » [archive], isogg.org, sur isogg.org.
• snpdev, « Reference SNP (refSNP) Cluster Report: rs9341296 » [archive], nih.gov, sur nih.gov.
• snpdev, « Reference SNP (refSNP) Cluster Report: rs13447354 » [archive], nih.gov, sur nih.gov.
• « P30 »(Archive • Wikiwix • Archive.is • Google • Que faire ?) (consulté le 8 juillet 2017).
• « P40 »(Archive • Wikiwix • Archive.is • Google • Que faire ?) (consulté le 9 juillet 2017).
• Projets
• Haplogroupe I bases de données
• Haplogroup I1 Project at FTDNA [archive]
• Danish Demes Regional DNA Project at FTDNA [archive]
• Haplogroup I-P109 Project [archive]
• British Isles DNA Project [archive]
• Bases de données générales ADN-Y
• Il existe plusieurs bases de données publiques mettant en vedette I-M253, y compris:
• http://www.eupedia.com/europe/european_y-dna_haplogroups.shtml [archive]
• http://www.semargl.me/ [archive]
• http://www.ysearch.org/ [archive]
• http://www.yhrd.org/ [archive]
• http://www.yfull.com/tree/I1/ [archive]

• Die Haplogruppe I1, auch I-M253 (L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157, L186, L187, M253, M307.2/P203.2, M450/S109, P30, P40, S63, S66, S107, S108, S110, S111) ist in der Humangenetik eine Haplogruppe des Y-Chromosoms und kommt, mit ihren Mutationen (SNPs), am häufigsten in Skandinavien vor. I1 ist eine Untergruppe der Haplogruppe I, die ausschließlich in Europa existiert.
• Vor der Reklassifizierung 2008[1] trug sie den Namen I1a.[2]
• Die Gruppe I1 tritt vor allem am häufigsten im Westen von Finnland (bis zu 40 %), in Süd-Norwegen (35 %) sowie gefolgt von Schweden (besonders auf der Insel Gotland) und in Dänemark und Norddeutschland auf.[3]
• In seinem Buch Blood of Isles gab der Professor und Autor Bryan Sykes dem Stammvater der Haplogruppe I1 den Namen Wodan, wie er es auch schon in seinem ersten Buch Die sieben Töchter Evas mit den Urmüttern der europäischen mitochondrialen Haplogruppen tat.
• Ursprünge
• Über mehrere Jahre bestand die vorherrschende Meinung, dass die Vorgänger der Gruppe I1 während der letzten Eiszeit Zuflucht am Balkan gesucht haben. Das Alter der Haplogruppe wird auf 15.000 bis 20.000 Jahre geschätzt.
• Das 'The Genographic Project' der National Geographic Society meint, dass die Gründer der I1-Gruppe während der letzten Eiszeit auf der Iberischen Halbinsel lebten. Einige Forscher haben auch Südfrankreich und die italienische Halbinsel als möglichen Rückzugspunkt angegeben.
• FamilyTree DNA hingegen gibt an, dass die Haplogruppe wesentlich jünger ist (4000 bis 5000 Jahre)[4].
• Prof. Dr. Kenneth Nordtvedt von der Montana State University ist aufgrund seiner Forschungsergebnisse ebenfalls der Ansicht, dass die Haplogruppe I1 eine frühere Untergruppe darstellt und wahrscheinlich erst nach der letzten Eiszeit existierte. Ebenfalls nach Nordtvedt lebte der letzte gemeinsame Vorfahre (MRCA) von I1 vor 4.000 bis 6.000 Jahren, und zwar wahrscheinlich in Nordmitteleuropa im Großraum des unteren Elbebeckens.
• Nach dem Ergebnis einer Studie aus dem Jahr 2010 entstand I1 (I-M253) im chalkolithischen Europa im Zeitraum zwischen 3.170 und 5.000 Jahren vor heute.[5]
• Eine neuere Studie aus dem Jahr 2015 schätzte den Ursprung von I1 (I-M253) auf den Zeitraum zwischen 3.470 and 5.070 Jahren oder zwischen 3.180 and 3.760 Jahren vor heute, ausgehend von zwei unterschiedlichen Untersuchungsmethoden.[6]
• Nach neuestem Stand (Sept. 2019) ist I1 (I-M253) lt. Y-Full jedoch bereits vor 27.500 Jahren v.h. entstanden (95 CI: 29.800 – 25.200 Jahre v.h.) mit einem TMRCA vor 4.600 v.h. (95 CI: 5.200 – 4.000 Jahre v.h.).[7]
• Eine Studie in Ungarn entdeckte im Jahre 2014 Überreste zweier Angehöriger der Östlichen Linearbandkeramischen Kultur, von denen einer die SNP M253 trug, die die Haplogruppe I1 definiert. Die Östliche Linearbandkeramische Kultur datiert zwischen ca. 5.500 v. Chr. und 4.900 v. Chr.
• Die Nachkommen sind überwiegend bei der germanischen Bevölkerung in Nordeuropa und der angrenzenden uralischen Bevölkerung zu suchen, obwohl diese auch in den traditionellen germanischen Ländern durch die zahlreich verbreitete Haplogruppe R überschattet werden. Peter A. Underhill vom Human Population Genetics Laboratory der Stanford University und andere Wissenschaftler unterstützen diese Hypothese.
• Der Marker DYS462 weist auf einen geografischen Unterschied hin. Laut Nordtvedts Studie deuten 12 Allel-Wiederholungen eher auf angelsächsischen Ursprung hin, wogegen 13 Allele eher auf nordischen Ursprung deuten.
• Sind bei dem STR-Test bei dem Marker DYS455 8 Allel-Wiederholungen, kann Haplogruppe I1 akkurat vorhergesagt werden (Wahrscheinlichkeit 99,3 zu 99,8 Prozent gemäß Whit Athey und Vince Vinzachero)[8]. Die SNP müssen dafür noch nicht getestet sein. Dies ist praktisch omnipräsent bei der Haplogruppe I1.
• Berühmte Vertreter der Haplogruppe I1
• Alexander Hamilton, Politiker und einer der Gründerväter der Vereinigten Staaten. Ermittelt anhand der Y-DNA der Nachkommen Hamiltons.[9]
• Birger Jarl (Birger Magnusson von Bjälbo), Jarl von Schweden und Gründer Stockholms. Seine Grablege wurde 2002 geöffnet, seine Knochen exhumiert und seine DNA mittels Pyrosequenzierung ermittelt.[10]
• Der Nachfahre des Schriftstellers Leo Tolstoy, Pyotr Tolstoy, konnte ebenfalls I1-positiv getestet werden.[11]
• Håkon Wium Lie, (CTO) bei Opera Software und bekannt für den Vorschlag zur Einführung von Cascading Style Sheets.[12]
• Einzelnachweise
• New binary polymorphisms reshape and increase resolution of the human Y chromosomal haplogroup tree Tatiana M. Karafet et al. (2008)
• Clade I Information from rootsweb Research Paper Tatiana M. Karafet et al. (2008)
• Migration Waves to the Baltic Sea Region, Annals of Human Genetics, The Authors Journal compilation (2008) doi:10.1111/j.1469-1809.2007.00429.x
• yDNA Haplogroup I: Subclade I1 FTDNA Information
• Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
• TMRCAs of major haplogroups in Europe estimated using two methods. Large-scale recent expansion of European patrilineages shown by population resequencing : Nature Communications : Nature Publishing Group. Abgerufen am 19. Mai 2015.
• I1 (englisch) yfull.com. 21. Oktober 2019. Abgerufen am 19. November 2019.
• Allele Frequency of I1a (Memento des Originals vom 10. Februar 2012 im Internet Archive) i Info: Der Archivlink wurde automatisch eingesetzt und noch nicht geprüft. Bitte prüfe Original- und Archivlink gemäß Anleitung und entferne dann diesen Hinweis. (PDF; 8 kB) Vizachero, Allele Frequency Among I1a Samples (2006)
• HAMILTON SURNAME DNA RESULTS AND DISCUSSION Hamilton Surname Project (start 2002)
• Finding the founder of Stockholm - A kinship study based on Y-chromosomal, autosomal and mitochondrial DNA Annals of Anatomy – Anatomischer Anzeiger/ Helena Malmström et al. (2011)
• Famous People with Haplogroup I1 Eupedia.com Haplogroup I1
• Håkon. (Nicht mehr online verfügbar.) opera.com, archiviert vom Original am 6. September 2008; abgerufen am 12. Oktober 2013. i Info: Der Archivlink wurde automatisch eingesetzt und noch nicht geprüft. Bitte prüfe Original- und Archivlink gemäß Anleitung und entferne dann diesen Hinweis.

• Aplogruppo I-M253
• Questa voce o sezione sull'argomento genetica non è ancora formattata secondo gli standard.
• Contribuisci a migliorarla secondo le convenzioni di Wikipedia. Segui i suggerimenti del progetto di riferimento.
• Aplogruppo I-M253, noto anche come I1, è un aplogruppo del cromosoma Y. I marcatori genetici confermati come identificativi I-M253 sono i SNP M253, M307.2 / P203.2, M450 / S109, P30, P40, L64, L75, L80, L81, L118, L121 / S62, L123, L124 / S64, L125 / S65, L157.1, L186 e L187. È un ramo primario dell'aplogruppo I-M170 (I *).
• L'aplogruppo raggiunge le sue frequenze più alte in Svezia (52 % dei maschi nella contea di Västra Götaland) e nella Finlandia occidentale (più del 50 % nella provincia di Satakunta). In termini di medie nazionali, I-M253 si trova in 35-38 % degli uomini svedesi, 32,8% dei maschi danesi, circa di 31,5% dei maschi norveges], e circa di 28% maschi finlandesi.[4]
• l'aplogruppo I-M253 è un ramo primario dell'aplogruppo I * (I-M170), presente in Europa fin dai tempi antichi. L'altro ramo primario di I * è I-M438, noto anche come I2.
• Prima di una riclassificazione nel 2008, il gruppo era conosciuto come I1a, un nome che da allora è stato riassegnato ad un ramo primario, aplogruppo I-DF29. Gli altri rami primari di I1 (M253) sono I1b (S249 / Z131) e I1c (Y18119 / Z17925).
• Indice
• 1 Origini
• 2 Struttura
• 3 Distribuzione geografica
• 3.1 Svezia
• 3.2 Danimarca
• 3.3 Norvegia
• 3.4 Finlandia
• 3.5 Gran Bretagna
• 4 Membri importanti di I-M253
• 5 Marcatori
• 6 Note
• 6.1 Progetti
• Origini
• Secondo uno studio pubblicato nel 2010, I-M253 è nato tra 3.170 e 5.000 anni fa, nell'Europa Calcolitica.[5] Un nuovo studio nel 2015 ha stimato l'origine fra 3 470 e 5 070 anni fa o fra 3 180 e 3 760 anni fa, utilizzando due tecniche diverse tecniche.[6] Si ha suggerito di essere stato disperso inizialmente dall'area che è ora la Danimarca.[7]
• Uno studio 2014 in Ungheria scoprì resti di nove individui della Cultura della ceramica lineare, di cui uno fu trovato portando il M253 SNP che definisce l'aplogruppo I1. Si ritiene che questa cultura sia stata presente tra 6.500 e 7.500 anni fa.[8]
• Struttura
• I-M253 (M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1 [9]
• I-DF29 (DF29/S438); I1a
• I-CTS6364 (CTS6364/Z2336); I1a1
• I-M227; I1a1a
• I-L22 (L22/S142); I1a1b
• I-P109; I1a1b1
• I-L205 (L205.1/L939.1/S239.1); I1a1b2
• I-Z74; I1a1b3
• I-L300 (L300/S241); I1a1b4
• I-L287
• I-L258 (L258/S335)
• I-L813
• I-Z58 (S244/Z58); I1a2
• I-Z59 (S246/Z59); I1a2a
• I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
• I-Z140 (Z140, Z141)
• I-L338
• I-F2642 (F2642)
• I-Z73
• I-L1302
• I-L573
• I-L803
• I-Z382; I1a2a2
• I-Z138 (S296/Z138, Z139); I1a2b
• I-Z2541
• I-Z63 (S243/Z63); I1a3
• I-BY151; I1a3a
• I-L849.2; I1a3a1
• I-BY351; I1a3a2
• I-CTS10345
• I-Y10994
• I-Y7075
• I-S2078
• I-S2077
• I-Y2245 (Y2245/PR683)
• I-L1237
• I-FGC9550
• I-S10360
• I-S15301
• I-Y7234
• I-BY62 (BY62); I1a3a3
• I-Z131 (Z131/S249); I1b
• I-CTS6397; I1b1
• I-Z17943 (Y18119/Z17925, S2304/Z17937); I1c
• Distribuzione geografica
• I-M253 si trova alla sua massima densità nell'Europa settentrionale e in altri paesi che hanno vissuto una vasta migrazione dall'Europa settentrionale, sia nel Periodo di Migrazione che nel periodo vichingo o nei tempi moderni. Si trova in tutti i luoghi invasi dagli antichi Popoli Germanici e dai Vichinghi.
• Durante l'epoca moderna, le popolazioni I-M253 si sono anche radicate nelle nazioni d'immigrati ed ex-colonie europee come gli Stati Uniti, l'Australia e il Canada.
• Population Sample size I (total) I1 (I-M253) I1a1a (I-M227) Source
• Austria 43 9.3 2.3 0.0 Underhill et al. 2007
• Bielorussia: Vitebsk 100 15 1.0 0.0 Underhill et al. 2007
• Bielorussia: Brest 97 20.6 1.0 0.0 Underhill et al. 2007
• Bosnia 100 42 2.0 0.0 Rootsi et al. 2004
• Bulgaria 808 26.6 4.3 0.0 Karachanak et al. 2013
• Repubblica Ceca 47 31.9 8.5 0.0 Underhill et al. 2007
• Repubblica Ceca 53 17.0 1.9 0.0 Rootsi et al. 2004
• Danimarca 122 39.3 32.8 0.0 Underhill et al. 2007
• Inghilterra 104 19.2 15.4 0.0 Underhill et al. 2007
• Estonia 210 18.6 14.8 0.5 Rootsi et al. 2004
• Estonia 118 11.9 Lappalainen et al. 2008
• Finlandia (nazionale) 28.0 Lappalainen et al. 2006
• Finlandia: ovest 230 40 Lappalainen et al. 2008
• Finlandia: est 306 19 Lappalainen et al. 2008
• Finlandia: regione di Satakunta 50+ Lappalainen et al. 20089
• Francia 58 17.2 8.6 1.7 Underhill et al. 2007
• Francia 12 16.7 16.7 0.0 Cann et al. 2002
• Francia (Bassa- Normandia) 42 21.4 11.9 0.0 Rootsi et al. 2004
• Germania 125 24 15.2 0.0 Underhill et al. 2007
• Grecia 171 15.8 2.3 0.0 Underhill et al. 2007
• Ungheria 113 25.7 13.3 0.0 Rootsi et al. 2004
• Irlanda 100 11 6.0 0.0 Underhill et al. 2007
• Tartari di Kazan 53 13.2 11.3 0.0 Trofimova 2015
• Lettonia 113 3.5 Lappalainen et al. 2008
• Lituania 164 4.9 Lappalainen et al. 2008
• Olanda 93 20.4 14 0.0 Underhill et al. 2007
• Norvegia 2826 31.5 Eupedia 2017
• Russia (nazionale) 16 25 12.5 0.0 Cann et al. 2002
• Russia: Pskov 130 16.9 5.4 0.0 Underhill et al. 2007
• Russia: Kostroma 53 26.4 11.3 0.0 Underhill et al. 2007
• Russia: Smolensk 103 12.6 1.9 0.0 Underhill et al. 2007
• Russia: Voronez 96 19.8 3.1 0.0 Underhill et al. 2007
• Russia: Arkhangelsk 145 15.8 7.6 0.0 Underhill et al. 2007
• Russia: Cosacchi 89 24.7 4.5 0.0 Underhill et al. 2007
• Russia: Careliani 140 10 8.6 0.0 Underhill et al. 2007
• Russia: Careliani 132 15.2 Lappalainen et al. 2008
• Russia: Vepsa 39 5.1 2.6 0.0 Underhill et al. 2007
• Slovacchia 70 14.3 4.3 0.0 Rootsi et al. 2004
• Slovenia 95 26.3 7.4 0.0 Underhill et al. 2007
• Svezia (nazionale) 160 35.6 Lappalainen et al. 2008
• Svezia (nazionale) 38.0 Lappalainen et al. 2009
• Svezia: Västra Götaland 52 Lappalainen et al. 2009
• Svizzera 144 7.6 5.6 0.0 Rootsi et al. 2004
• Turchia 523 5.4 1.1 0.0 Underhill et al. 2007
• Ucraina: Lvov 101 23.8 4.9 0.0 Underhill et al. 2007
• Ucraina: Ivanovo-Frankov 56 21.4 1.8 0.0 Underhill et al. 2007
• Ucraina: Hmelnitz 176 26.2 6.1 0.0 Underhill et al. 2007
• Ucraina: Cherkassy 114 28.1 4.3 0.0 Underhill et al. 2007
• Ucraina: Belgorod 56 26.8 5.3 0.0 Underhill et al. 2007
• Svezia
• Danimarca
• Norvegia
• Finlandia
• Gran Bretagna
• Mappa che mostra la distribuzione dei cromosomi Y in una sezione trasversale dell'Inghilterra e il Galles dal documento " Evidenza del cromosoma Y per la migrazione massiva anglosassone". Gli autori attribuiscono le differenze nelle frequenze di aplogruppo I alla migrazione massiva anglosassone in Inghilterra, ma non nel Galles.
• Nel 2002 fu pubblicato un lavoro da parte di Michael E. Weale e colleghi che mostravano evidenze genetiche per le differenze di popolazione tra le popolazioni inglesi e gallesi, tra cui un livello notevolmente superiore di aplogruppo Y-ADN I in Inghilterra che nel Galles. Lo hanno visto come testimonianza convincente dell'invasione massiva anglosassone della Gran Bretagna orientale dalla Germania settentrionale e dalla Danimarca durante il periodo migratorio. Gli autori presumono che le popolazioni con grandi proporzioni di aplogruppo I provenivano dalla Germania settentrionale o dalla Scandinavia meridionale, in particolare dalla Danimarca, e che i loro antenati sarebbero migrati attraverso il Mare del Nord con le migrazioni anglosassoni e i vichinghi danesi. L'affermazione principale dei ricercatori era:
• Che sarebbe stato necessario un evento di immigrazione anglosassone che interessasse al 50-100% del corredo genetico maschile dell'Inghilterra centrale in quel momento. Ricordiamo tuttavia che i nostri dati non ci permettono di distinguere un evento che semplicemente aggiunse al corredo maschile indigena inglese centrale indiana da quello in cui i maschi indigeni sono stati sfollati altrove o uno dove i maschi indigeni furono ridotti in numero ... Questo studio dimostra che il confine gallese fu più una barriera genetica al flusso genetico anglosassone del cromosoma Y che il Mare del Nord ... Questi risultati indicano che un confine politico può essere più importante di quello geofisico nella strutturazione genetica della popolazione.
• Distribuzione di applogruppi di cromosoma Y da Capelli et al. (2003). Applogruppi I è presente in tutte le popolazioni, con frequenze più alte in oriente e frequenze inferiori in occidente. Sembra che non ci sia un confine discontinuo come osservato da Weale et al. (2002)
• Nel 2003 è stato pubblicato un articolo da Christian Capelli e colleghi che sostiene, ma modificate, le conclusioni di Weale e colleghi. Questo documento, che ha campionato la Gran Bretagna e l'Irlanda su una griglia, ha trovato delle differenze minore tra i campioni gallesi e inglesi, con una graduale diminuzione della frequenza dell'aplogruppo I se si muove verso ovest al sud della Gran Bretagna. I risultati hanno suggerito agli autori che gli invasori vichinghi norvegesi avrebbero influenzato fortemente l'area settentrionale delle isole britanniche, ma che i campioni sia inglesi che scozzesi (dall'isola principale) hanno tutti influenza tedesca / danese.
• Membri importanti di I-M253
• Alexander Hamilton, attraverso la genealogia e le analisi dei suoi discendenti (assumendo una paternità reale corrispondente alla sua genealogia), è stato messo all'interno dell'aplogruppo I-M253 di Y-ADN.[10]
• Birger Jarl, "Duca di Svezia" della Casa dei Goti di Bjalbo, fondatore di Stoccolma, i cui resti sepolti in chiesa sono stati fatti testare nel 2002 e si è scoperto di essere anche I-M253
• I Passeggeri del Mayflower William Brewster, Edward Winslow e George Soule per il test del DNA
• Marcatori
• Esempio di ADN: il filamento 1 differisce dal filamento 2 in una singola posizione di coppia base (un polimorfismo C >> T).
• Successivamente sono riportate le specifiche tecniche noti per le mutazioni SNP e STR dell'aplogruppo I-M253.
• Nome: M253
• Tipo: SNP
• Fonte: M (Peter Underhill dell'Università di Stanford)
• Posizione: ChrY: 13532101..13532101 (+ filamento)
• Posizione (coppia di base): 283
• Dimensioni totali (coppie di base): 400
• Lunghezza: 1
• ISOGG HG: I1
• Innesco F (Guida 5 '→ 3'): GCAACAATGAGGGTTTTTTTG
• Innesco R (Ritardo 5 '→ 3'): CAGCTCCACCTCTATGCAGTTT
• YCC HG: I1
• Cambi degli alleli nucleotidi (mutazione): da C a T
• Nome: M30
• Tipo: SNP
• Fonte: M (Peter Underhill)
• Posizione: ChrY:21160339..21160339 (+filamento)
• Lunghezza: 1
• ISOGG HG: I1
• Innesco F: TTATTGGCATTTCAGGAAGTG
• Innesco R: GGGTGAGGCAGGAAAATAGC
• YCC HG: I1
• Cambi degli alleli nucleotidi (mutazione): da G a A
• Nome: P30
• Tipo: SNP
• Fonte: PS (Michael Hammer dell'Università dell'Arizona e James F. Wilson, dall'Università di Edimburgo)
• Posizione: ChrY:13006761..13006761 (+ filamento)
• Lunghezza: 1
• ISOGG HG: I1
• Innesco F: GGTGGGCTGTTTGAAAAAGA
• Innesco R: AGCCAAATACCAGTCGTCAC
• YCC HG: I1
• Cambi degli alleli nucleotidi (mutazione): da G to A
• Regione: ARSDP
• Nome: P40
• Tipo: SNP
• Fonte: PS (Michael Hammer e James F. Wilson)
• Posizione: ChrY:12994402.12994402 (+ filamento)
• Lunghezza: 1 ISOGG HG: I1
• Innesco F: GGAGAAAAGGTGAGAAACC
• Innesco R: GGACAAGGGGCAGATT
• YCC HG: I1
• Cambi degli alleli nucleotidi (mutazione)): C to T
• Regione: ARSDP
• Note
• ^ T. Lappalainen, V. Laitinen, E. Salmela, P. Andersen, K. Huoponen, M.-L. Savontaus e P. Lahermo, Migration Waves to the Baltic Sea Region, in Annals of Human Genetics, vol. 72, n. 3, 2008, pp. 337–348, DOI:10.1111/j.1469-1809.2007.00429.x, PMID 18294359.
• ^ T. Lappalainen, U. Hannelius, E. Salmela, U. von Döbeln, C. M. Lindgren, K. Huoponen, M.-L. Savontaus, J. Kere e P. Lahermo, Population Structure in Contemporary Sweden: A Y-Chromosomal and Mitochondrial DNA Analysis, in Annals of Human Genetics, vol. 73, n. 1, 2009, pp. 61–73, DOI:10.1111/j.1469-1809.2008.00487.x, PMID 19040656.
• ^ Eupedia, "Distribution of European Y-chromosome DNA (Y-DNA) haplogroups by country in percentage" (31 January 2017) .
• ^ Lappalainen T., Koivumäki S., Salmela E., Huoponen K., Sistonen P., Savontaus M.L., Lahermo P.; 2006, "Regional differences among the Finns: a Y-chromosomal perspective", Gene vol. 376, no. 2, pp.207-15.
• ^ Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, Current Biology, vol. 20 (February 23, 2010), R174–R183. yDNA Haplogroup I: Subclade I1, Family Tree DNA,
• ^ TMRCAs of major haplogroups in Europe estimated using two methods. : Large-scale recent expansion of European patrilineages shown by population resequencing : Nature Communications : Nature Publishing Group, su www.nature.com. URL consultato il 19 maggio 2015.
• ^ Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in Rethinking the Human Revolution (2007), pp. 33-42.
• ^ Tracing the genetic origin of Europe's first farmers reveals insights into their social organization, su biorxiv.org.
• ^ ISOGG, Y-DNA Haplogroup I and its Subclades - 2017 (31 January 2017).
• ^ Founding Father DNA, su isogg.org.
• Progetti
• Banche di dati aplogruppo I
• Haplogroup I1 Project at FTDNA
• Danish Demes Regional DNA Project at FTDNA
• Haplogroup I-P109 Project
• British Isles DNA Project
• Banche di dati generali Y-DNA
• Ci sono diversi banche di dati di accesso pubblico che includono I-M253, tra cui:
• http://www.eupedia.com/europe/european_y-dna_haplogroups.shtml
• http://www.semargl.me/ Archiviato il 7 luglio 2017 in Internet Archive.
• http://www.ysearch.org/ Archiviato il 4 gennaio 2011 in Internet Archive.
• https://www.yhrd.org/
• http://www.yfull.com/tree/I1/
• Aplogruppi del cromosoma Y umano